Welcome Guest [Log In] [Register]
7.10.17

  • The FFKT, Realm of Expressive Imagination, and RPG categories have been condensed into one category known as Member Creativity. That should de-clutter the main index a bit to make it easier for people to navigate.
  • 7.7.17

  • Due to Photobucket wanting a bulk payment of $400 a year to host images with no other payment options, we are currently looking for another site to host our forum graphics. We appreciate your patience until this process is over.
  • 7.6.17

  • Kaiju Section is going through an overhaul again. We'll be splitting it back into franchises, since not all franchises have the Godzilla series' Showa/Heisei/Millennium split.
  • Check out and vote in our poll in the Kaiju Galaxy Forum section regarding whether we should add a section for the Kamen Rider franchise!
  • 7.1.17

  • Age of Heroes will be getting a reboot! Join in on our superhero RPG!
  • 3.13.17

  • A very late happy 2017!
  • Welcome to Kaijugalaxy. We hope you enjoy your visit.


    You're currently viewing our forum as a guest. This means you are limited to certain areas of the board and there are some features you can't use. If you join our community, you'll be able to access member-only sections, and use many member-only features such as customizing your profile, sending personal messages, and voting in polls. Registration is simple, fast, and completely free.


    Join our community!


    If you're already a member please log in to your account to access all of our features:

    Username:   Password:
    Add Reply
    Godzilla vs Chimerus I; The Nightmare Continues
    Topic Started: Jun 17 2006, 09:10 PM (537 Views)
    Zardac the Great
    Member Avatar
    Light Side Sith
    I have now re written Godzilla vs. Chimerus I. I hope it is a lot better.

    Just so everyone knows, this is part 2 of the Nightmare Series, and starts just after Wishes of a Godzilla fan ends.

    For those of you who want to read the first one, it is here:

    http://z4.invisionfree.com/KaijuGalaxy/ind...?showtopic=1368

    I can't stress enough that this is an alternate reality and not the world you know and love. Here the Soviet Union still exists, and rules half the world.

    I will post the backstory for the Nightmare Series later, but for now, enjoy the rewritten, and hopefully much improved Godzilla vs. Chimerus I.
    Read Stardate 5438 at KaijuGalaxy now!


    Posted Image


    FFKT TOKENS: 15
    Offline Profile Quote Post Goto Top
     
    Zardac the Great
    Member Avatar
    Light Side Sith


    Won Park sat in his seat in the Osprey-jet over the Pacific ocean. If he'd been standing, he'd have been about 5'4". Ordinarily, he'd be either sitting fairly straight-backed, perhaps watching the news, or silently contemplating the world's situation, or he'd be leaning forward, planning some new operation in their eternal quest to kill off Godzilla.

    However, right now Park wasn't sitting straight-backed nor was he leaning forward. He wasn't watching the news, listening to music, eating a sandwhich, reading a book, or planning anything.

    He was reviewing the events of the last few weeks- again. Specifically, he kept going over the attempt he had just made- successfully- to get Godzilla's blood. They had landed in Japan, met with the Emperor, and evacuated most of Japan. As expected, Godzilla had shown up to kill as many of the evacuees as possible. George McCool and his double from another dimension, a dimension where Godzilla only existed as a movie!, led the attempt to get Godzilla's blood.

    The attempt was successful, but it came with a price. Both George McCools were missing and assumed dead. Their airplane had to leave without them to avoid getting destroyed by Godzilla.

    Park contemplated this. Godzilla could have easily vaporized the plane with his breath, but he didn't. That meant that he didn't want to. Godzilla did anything, and everything, he wanted to.

    But why?

    Park wasn't thinking clearly. He knew he wasn't, but he couldn't help it. He had admired George very much. George had been the brains behind the basic idea of Project Regisaur, and had been the spirit behind the whole thing. Throughout the whole thing, from the first stages when the Project was just getting organized, through the big Debate that Brandon Cain had eventually won, through the coup in the aftermath of the Black Hole bomb, all the way to just, what, two and a half hours ago, when the plane took off, leaving both McCools behind.

    Leaving them behind with Godzilla.

    Godzilla would have definitely killed them by now. Godzilla destroyed everything. That was what Godzilla was- a Destroyer, with a capital "D." Godzilla showed no mercy.

    But Park had Godzilla's blood. That was what George had wanted. He said that it would make their regisaurs stronger. They would have a better chance of killing Godzilla. That was what George had lived for since Godzilla's March to the Mississippi. Godzilla's almost worldwide rampage had ended with Godzilla setting fire to the Amazon rain forest, decreasing global temperatures and resulting in a worldwide famine.

    That was one thing that had struck Park about George's double. He was a bit pudgy around his gut. Nobody Park had ever seen was fat at all. Food was rationed strictly in every country Park could think of. Things were less bad in America, but still, nobody had any excess fat.

    But now he was dead. Both George's were. They had to be.

    But they just couldn't be!

    But at least George would be happy that Park had the Godzilla blood. George would have been furious if Park had decided to have the plane stay around to try to pick him up. He had impressed this upon Park during the flight to Japan, after Godzilla disappeared.

    Grief eventually takes its toll on a person's mind, and after a while, Park fell asleep.


    ***


    Park's plane was one of hundreds that made it from Japan. All flights to LAX had to be rerouted so that the armada of rather bizzare aircraft could land. The airplanes they'd had to use were a jet-liner verison of the Osprey aircraft the Marines had been experimenting with. They'd had to use such aircraft for several reasons, ranging from the fact that Godzilla's rampages had destroyed every regular runway, to the fact that Soviet controlled China and Korea, the land of Park's parent's birth, had refused to let them use either their airspace or their runways.

    As Park loaded the lead box containing Godzilla's blood (the syringe missile would have melted hours ago) into the waiting truck, he saw the Japanese everywhere. A few were crying over loved ones who had died along the way of various cancers, but most of the emaciated, scarred people were extremely happy. They were happy to be away from "Him." They kissed the ground, kissed each other, talked about their plans to move to the East Coast to get further away from Godzilla, danced, sang, and generally celebrated their good fortune.

    George would have liked it, Park decided. He'd always cared for people, and had been outraged at the plight of the Japanese suffering under Godzilla, and the plight of the rest of the Asians, and a large portion of the Africans, suffering under Soviet domination. The thought of George and his rants against both Godzilla and the Soviet Union got his mind working again, and once again, he remembered what had just happened. He got in the back seat of the vehicle, slammed the door, and told his driver to drive.


    ***

    "Okay!" George yelled. "Out of the plane! NOW!" With that, he jumped out and rolled. Then Park and several Japanese soldiers jumped out, rolling when they hit the ground, and the plane started pulling away while George's double from the Godzilla-less universe hesitated before jumping out. He hadn't rolled, and had hurt himself upon landing.

    "You should have rolled," Park told him.

    In the distance, Park heard the boom of one of Godzilla's footsteps and Godzilla's roar followed by George shouting orders to the soldiers who had come with them.

    "Okay! You missile teams! Spread out! I want three unique firing positions, because we're not sure which angle will be the best! Wait for my orders!"

    The soldiers split off by twos and went their seperate directions.

    "Park, you got the radio?"

    "I do!" Park answered.

    "Get it out! I'll get the map, and we can find the best place to launch our attack!"

    This seemed to confuse Godzilla-less George. "I thought you said we wern't trying to kill Godzilla!"

    George waved his double off. "Not right now! Let us think!"

    Park started assembling the antenna on the radio, and within thirty seconds, it was ready. He'd only needed to screw one piece into the block. He quickly plopped down by George to plan their attack. He vaugley noticed that in the background, people were screaming and planes took off, while Godzilla continued his rather lackadasical advance.

    "Look! Godzilla's back is glowing!"

    George's double had alerted them to a very important fact, and Park would have felt stupid for not watching for that himself if he hadn't been so terrified by the thought of what it meant.

    "Do not look at him! Get down!" Park shouted as he covered his head on the ground. The thought struck him that he was cowering before Godzilla, something he'd promised himself he wouldn't do, but right then he didn't care too much. He knew what was coming. He felt the blistering heat and heard the whoosh that hearalded the blast of Godzilla's thermonuclear plasma breath.

    When it was over, he sat back up and looked over his shoulder. He'd wished he hadn't. The landscape was charred, and grass and trees were on fire. Most of what had been there had been vaporized by Godzilla's breath, for that's what it did. It didn't explode or cause explosions. It simply vaporized everything it touched, and caused fires where it didn't quite touch.

    George saw the damage and in the sudden quiet, he calmly told Park, "I think he's in a perfect location right now. Wouldn't you say, Park? Call the military and have them strike."

    "Striker ten-one, this is King Ghidorah," Park radioed, using the codename supplied by the Godzilla-less George, the name of "Godzilla's greatest enemy."

    "This is Striker ten-one. We read you loud and clear Ghidorah."

    "Striker ten-one, launch your missiles. Coordinates are set Sakura, 34,10."

    "Roger that. Launching missiles.

    "Lightning three-two, this is King Ghidorah."

    "King Ghidorah, we read you loud and clear. What do you want us to do?"

    "Lightning, launch your fastest planes with your biggest missiles. Coordinates are set Sakura, 34,10."

    "Roger that, sir. We will be there soon."

    "Hailstorm group, this is King Ghidorah."

    "Welcome, King. This is Hailstorm. You need some artillery?"

    "Set Sakura, coordinates 34, 10. Blast him for me."

    "You got it sir. Artillery bombardment underway."

    "Dealer group, this is King Ghidorah. Stand by for our orders."

    "Roger that sir."

    The rocket artillery was the first to hit Godzilla, being the closest to him. Against a tank regiment, those rockets would be incredibly deadly, but against Godzilla, they looked like smoking splinters. Then the planes showed up. The remaining aircraft of the JSDF air force began attacking Godzilla, and more than once, an F-15 would kamakasie into Godzilla with all missiles still under the wings. However, Godzilla's breath soon ended the the attack from aircraft.

    But more was to come.

    Cruise missiles came streaking at him. They needed to impact the same place to make Godzilla's skin as thin as possible somewhere for the syrringe missiles to have the best chance possible. That meant that they were travelling in three lines towards Godzilla.

    Godzilla seemed to reflect on the advancing missiles, then chose one line and vaporised it. As the other two groups of missiles pounded into him, he grinned. When the fires cleared away he was still there, grinning, looking like nothing had happened.

    Park grabbed the radio again. "Now! Fire!"

    Dealer group fired the syrringe missiles from their shoulder mounted rocket launchers. The missiles streaked towards the locations that looked like they'd taken the most the most damage.

    Godzilla had seen where the rockets had come from, and vaporised the locations with his breath. Park knew that the teams had started running as soon as they'd shot, but surely they were dead now. What Park had to think about now was the syringe missiles. One by one, they filled up and blasted back off of Godzilla's body. One blasted back towards Park and the two Geroge's, functioning as it was supposed to.

    Park ignored the two that had malfunctioned and rushed forward to grab the remaining one. When he got it, he sprinted back towards the others with the syringe missile. The plane was coming to the ground again, to pick them up. George saw the missile and shouted, astonished, "Look! The needle melted!"

    "Isn't that radioactive?" Godzilla-less George asked.

    "The shell is three centimeters of lead. It should let no radiation out."

    "Right," George said. "Well, we have what we came for. Let's go."

    They rushed to the plane, the door of which was down, waiting for them to climb in. Park got on first, since he had the blood, but Godzilla was coming. The pilot hit a switch that shut the door, and neither George could get in. The plane took off vertically, leaving both George's behind, with Godzilla coming in.

    Park couldn't move. he couldn't get to a seat, he couldn't get to a window, but he could still see George standing there, and could hear him talking to him. That made no sense because he was now a hundred feet in the air, and the radio was still on the ground.

    Well, Park. You got away. You have the Godzilla blood."

    "But you are still down there!" Park yelled.

    "You blame yourself? You would rather be down here with Godzilla?"

    "Yes!"

    "Don't be stupid. You remember what I told you back home. Death is nothing for me. I know Jesus, and I'll see Him soon. I'm just glad I could die doing something for these people.

    Then, with Park still somehow watching, Godzilla laughed at them and vaporised the two Georges with his breath.

    At that point, Park suddenly woke up in an uncomfortable car with his legs cramped from staying in the same position for too long. He shifted his position as best he could, but was soon staring back into space, reliving the experience awake as much as he had asleep.


    ***

    It was a long and uncomfortable ride, but three days and several states later, Park's vehicle made it to the University that now housed Project Regisaur. He hadn't said much to the driver other than to agree that they could stop at a motel. He didn't even know who his driver was. This now struck him as a rather risky arangement, but it was too late now. Park took the lead box up to the Project lab and left it with Juan Saiz, the Project geneticist.

    Juan was a native of Roswell, New Mexico. He spoke English with a slight Southwestern accent, and though he had Mexican heritage, he spoke no Spanish. He was of what had become average height since the Godzilla Induced Global Cooling Famine had begun, 5'6". He now had a laboratory that had the best equipment available, due to his being a part of the Anti-Godzilla group. Someone, they werent' sure who, was giving very liberally to their group.

    "You got Godzilla's blood then? I'm impressed!" Juan exclaimed as Park came in with the box.

    "Yes." the Korean said simply.

    Park's tone of voice grabbed Juan's attention, and he noticed the haunted look in Park's eyes.

    "What's wrong?" he asked. Then his eyes widened and he suddenly wondered why George wasn't there. "Where's George?"

    Park's face suddenly spoke volumes to Juan, but he wanted to hear it to make sure.

    Park on the other hand, didn't want to say it. If he said it, it would make it true. Final. But, on the other hand, it was true, wasn't it? He suddenly remembered George's occasional philosophic rambles in between planning sessions, and outside where it was illegal to talk about their Target.

    "Always tell the truth," George had told him on one such occasion. "The rightness of telling the truth, and the wrongness of lying aside, if you lie, you're going to dig yourself into a pit. You have to remember which lies you told to whom, and eventually you'll slip up and be found out. And once your found out, you have no credibility. Nobody will trust you. Nobody will listen to you. Telling the truth is far better than telling a lie."

    Park sighed. "George is dead," he told Juan. We had lo leave him behind in Japan. Godzilla will have gotten him by now."

    Juan deflated a little.

    "That's bad," he said at last.

    Park said nothing. He was already beginning to retreat back into his thoughts again.

    Juan abruptly snapped both of them out of their thoughts.

    "Well, there is a meeting tomorrow, since you're back," he said with a sigh. "You know Brandon will try to take over again. There will have to be another vote since George is dead, and it will be close. Brandon will try to use the fact that Godzilla killed George as evidence that his idea was not good."

    "It had nothing to do with that!" Park insisted. "We just had some bad luck! After all, this is Godzilla we're talking about!"

    "I know that," Juan responded. "I'm just saying that he will say that. Some people will listen. After all, Brandon did survive his attempt. That leaves him with some clout."

    "Yes. He survived in an airplane a mile away," Park replied, dryly. "The one that actually dropped the bomb was vaporized. Along with some of his most heated opposition, I might add."

    "I hear what you're saying, Park, but he did survive. I'll tell you what. You look horrible. I'll start talking to people. You go to bed. It's up to you now, and I'll do everything I can to make sure you get chosen. Project Regisaur must go forward. The Black Hole bomb already showed it wouldn't work. This is probably our greatest hope-"

    Juan stopped talking abruptly as somebody walked into the lab. He hurriedly shoved the lead box under some papers. He didn't want anybody outside their anti-Godzilla group to hear anything about it. After all, it was illegal to mention Godzilla.

    "You go, and make sure you're at your best tomorrow. See you then."

    Park left Jaun's lab. Juan was right. He did need rest. He just wasn't sure he would get it.


    ***

    Park walked into the room where their group held their meetings, early as usual. It was windowless and sound proof- perfect for discussing things in secret. The only thing that could have made it more perfect would be to have it underground, but that wasn't possible at the moment. The University that housed their project had a restraunt in the underground area.

    The room had about thirty chairs sitting around a large, rectangular table, courtesy of the lunch room. At the front of the room, a chalk board adorned the walls, but given the fact that someone had a habit of swipeing chalk, it was hardly ever used. Park suspected that the theif was one of the math professors, but though great pomp was injected into the search, it could never be proven.

    At the other end of the room was something far more useful: a bank of computers was attached to a projector that could project an image onto a screen that could be pulled down in front of the chalk board. None of the computers was connected to the Internet however. That was all they needed, some hacker busting his way into the computers and gathering enough data to cause a scare, or worse, corupting the data.

    The side walls were covered with shelves. The shelves held a plethora of books, folders, models, and the like. One of them also held the Ballot Box that would be used that day for a new election to Project Head. Park was staring at the Ballot Box, but he wasn't really seeing it. His thoughts were swirling around again. He thought again of the final portion of the trip to Japan. He thought of the election that would be taking place because of it. Would he have the votes? If he lost, would the whole trip have been for naught? Or would whoever won shut Project Regisaur down completely? That was more likely. Project Heads didn't tend to like competeing projects. They tended to want to concentrate the group's resources, and Park knew this made sense. He also knew that if Brandon won, he wouldn't just cancel Project Regisaur, he'd actively try to eliminate every gain they'd made.

    Park's musings were interrupted by Tony, Project Regisaur's physist, entering the room and looking rather subdued, followed by Brandon and Heinz. They took their seats as Miles Fitzgerald entered the room. Soon, all thirty two remaining group members were in their seats. Park saw that some were chatting, some were reviewing notes, and some looked subdued, and maybe a little sad. Brandon looked rather sulky, Park noticed.

    Juan leaned over and whispered to Park that he'd better be seen as taking charge, so he should go and shut the door. So, Park rose to his feet, walked over to the door, and shut it.

    This simple action had dramatic effects. George had always come last, and he had always shut the door. He'd usually shut it while making some sort of pronouncement over his shoulder. George had hated pomp and ritual, so tended to do things to interrupt the regular flow of things. But, like anything done enough, this had become a bit of a ritual.

    "Where's George?" Joseph McNeal asked. He was one of the group's oldest members, about fifty years old. He was a survivor of Godzilla's March to the Mississippi, from late 1979- early 1980. What little hair he had left was in little white patches dotting his scalp, the product of a brief contact with a small ammount of residual radiation from Godzilla's rampage. He didn't have cancer, and he should have gotten over the effects of the radiation by now. The doctors weren't sure what he had.

    Park hesitated. He knew that he had to tell them. He couldn't get out of it, but he still didn't want to say it. However, he pulled himself together and looked McNeal in the eye.

    "George is almost certainly dead," He stated, then looked around the room. "We had to leave him behind. Godzilla was coming."

    Park saw the effect that the news had on different people. Most looked saddend. If nothing else, most people had gotten a laugh or two out of George's incessant jokes. A few looked totally non effected, and Brandon perked up a little at the news. Park wondered at the depravaty of someone who would be glad at the death of a collegue.

    The news also started a buzz of conversation. It started off slowly, but gradually picked up as the shock of the truth wore off. If George was dead, then there had to be a vote for Project Head. George must have set a record as the shortest living Project Head ever. Did this mean that Project Regisaur would be ended?

    The chatter went on until Park went to the computer bank and had the computer play a recording of Godzilla's roar. Every person present in the room immediately shut up and started wondering if Godzilla could be there.

    "I had the computer play that sound to get your attention," Park announced. "As the former Project Head is now deceased, the Rules and Laws of this group dictate that we take a vote to choose the new Project Head immediately. We will now take nominations."

    Juan immediately stood up. "I nominate Won Park to be Project Head, and continue Project Regisaur."

    Park looked for some chalk. Amazingly, there were two pieces. He wrote his name on the blackboard, folowed by "Project Regisaur."

    "I nominate Brandon Caine to be Project Head, and start his new Project, Operation Devastator," Heinz Zeigler said in his thick German accent.

    Park gritted his teeth as he wrote "Brandon Caine- Operation Devastator." The chalk broke on the hyphen due to the ammount of force Park used. He hoped that it subconciously turned people away from Brandon.

    "I nominate Miles Fitzgerald to be Project Head, and begin work on Operation Snakebite."

    Everybody in the room flinched. It was very rude, though not against the rules to nominate yourself, and that was what Miles Fitzgerald had done.

    Park wrote the required information on the board again, this time the chalk splintered, but didn't snap.

    Park waited for about five seconds, then asked, "Are there any more nominations?"

    Nobody had anymore, so Park said, "We will now begin with the explanations of the different Projects. Project Regisaurus is currently underway. The first phase is over. We obtained a blood sample from Godzilla, and we hope to use it to create five chimerial dinosaurs to fight him. With the backing of the Paleontology, Genetics, and Biology departments, we believe that we can have the chimerial dinosaurs ready to combat Godzilla in five years. You all have a copy of the specifics."

    Then Brandon rose to explain Operation Devastator.

    "Operation Devastator consists of building an Orbital Bombardment Laser with which to kill Godzilla from the safety of space. To avoid any international problems, controll of the OBL will be given to the United Nations, and accordingly, this group will fall under the auspices of the UN."

    That caused some murmuring around the room, but regulations dictated that it was now Miles' turn to speak. He took about five seconds.

    "Operation Snakebite is at once simple and complicated. The aim is to create a chemical agent to kill Godzilla. Very simple idea. Very complex action."

    When he was done talking, the Debate began. Park only caught some of it. He had gone back to thinking about leaving George behind in Japan, but he was snapped back into the present when a chemist, Yuri Burton, asked Miles why he was planning to make a poison, even though they had failed before.

    "Well, Project Regisaurus was gracious enough to obtain a blood sample from Godzilla. With Godzilla's genetic material, we should be able to design a toxin specifically for Godzilla."

    That took Park completely by suprise. He was now sure that Brandon had put Miles up to it to try to split the votes that would go against him. He decided to listen to the debate to try to see how successful Brandon had been. He heard Tony and Heinz arguing first. They were the loudest.

    "I'm telling you, lasers make horrible weapons, especially in space!" Tony was telling Heinz. "It will cauterize any wound it makes, thereby giving Godzilla a better chance to survive a hit. He will then heal whatever wound is caused. Also, lasers create a lot of heat. Where is that going to go? There is no way to cool it down!"

    "And giving it to the UN! Horrible idea!" Joseph joined in.

    Park agreed. The UN had certainly done nothing when South Korea was overrun by the Communists. The UN had done nothing when Godzilla flattened Seoul. Of course, the Soviets had seen their opportunity. The Americans had tried to organize some sort of action, but the Soviets had blocked it. Of course, even if the Soviets hadn't, Godzilla was in the area, and having Godzilla active in the area of operations would tend to prevent effective military action. Park's family had fled once the takeover was complete. The Communists were just too brutal. A "vacation" to China, Russia, and France eventually led them to seek asylum in America. After Godzilla's attack in China, the Soviets had rushed in with "aid." Godzilla prevented the Americans from doing anything about it. The long and short of it was, the Soviet Union ruled about two-thirds of the world from Moscow. They knew exactly how to play the diplomacy game, and so the UN was basically a covering for Soviet domination of the world. And all of it was Godzilla's fault, Park was sure.

    "Giving it to the UN is completely non-negotiable," Heinz declared. "The European Community is completely against the idea of the United States having sole controll of a weapon of this magnitude."

    Yeah. That sounded right, Park thought. The Europeans wanted to show their importance and independence, but in doing so, they really became the lap-dogs of the Soviets. He shifted his attention to another knot of people who were also arguing. It was a group that seemed to center around Juan and Phillipe de Lapparent, the Frenchman. They were also arguing over Operation Devastator.

    Park was getting worried. The more he listened, the more it seemed that the entire debate was over Operation Devastator. That was a bad thing. That meant that that's what most of the people were thinking about.

    Finally, the three of them were asked to leave the room. Park feared he knew the outcome. Brandon had brilliantly split the anti-Brandon vote, and he would win, Park had no doubt. It was the same thing that happened in American Politics. A third party would only cause the side they agreed with more to lose. People were unwilling to accept half of what they wanted, so they got nothing they did want, and everything they didn't.

    The voting didn't last long. They were led back in to the room to hear the announcement of the winner. Sure enough, when the final votes were tallied, Brandon won by one vote. Miles had split the other vote, taking three votes that Park had been sure would have gone to him.

    Brandon had a gloating look on his face as he sat in the chair at the head of the table. Park took his seat next to Jaun with a disgusted look.

    "What do we do now?" he whispered to Juan.

    "We keep working on it in secret, just like we did before."

    "You know what his first order is going to be, right?"

    Juan merely motioned towards Brandon, who was already speaking. They'd missed the first part of whatever he was saying. It might be important to know what he was up to.

    "...and so, as a backup plan, I think it wise to have Miles Fitzgerald to begin work on a toxin specifically designed for Godzilla. As Project Regisaur is no longer around, I think we should use the Godzilla blood taken for Operation Snakebite."

    There. He'd said it, and now, whether Brandon had put Miles up to it or not, Miles would definitely be in Brandon's camp.

    Brandon continued, "Also, as this Project is now under the auspices and guidance of the United Nations, a contingent of UN workers will arrive next week, pending US government approval. Heinz and Phillipe, I need you to get back with your home countries to get them putting pressure on the government.

    "I know this will be controversial, so I'm making an offer right now. Any one who absolutely refuses to work with the UN may leave right now, with no questions asked."

    Park, Juan, Tony, and Joseph all got up and walked out, but they were the only ones. Park was last in line, and as he was about to leave the room, Brandon called to him.

    "Park, are you familiar with the Global Defense Initiative?"

    Juan came back in when he heard Brandon speaking.

    "The new Global Army that was authorized last week." Heinz said.

    "Exactly. I see that Park didn't watch the news while he was in Japan. Well, Global Defense Initiative order 215 states that the attempted creation of chimeras without approval from the UN and the GDI is classified as an Extreme Felony by the World Court. Just thought you'd like to know."

    Juan pulled Park out of the room, and shut the door behind them.

    "You know, I think that's about the most dysfunctional group I've ever been a part of," Juan said one they were away from the room.

    "Tell me about it. And what's he talking about the World Court for?" Park ranted. "The World Court is an invention of the Soviets and the EU. It has no authority here!"

    "I know," Juan said, shaking his head. "He knows something though. He wouldn't have brought it up if he didn't."

    "We'd better get to the lab. The longer we wait, the more likely he is to take all of the blood.


    ***
    Read Stardate 5438 at KaijuGalaxy now!


    Posted Image


    FFKT TOKENS: 15
    Offline Profile Quote Post Goto Top
     
    Zardac the Great
    Member Avatar
    Light Side Sith

    Juan uncovered the lead box. It was still where he had hidden it the day before. He took the box over to a large machine. It looked like a gray box, about six feet tall and four feet wide, a bit wider at the base. Juan opened a panel in the top half of the machine, pulled out some tubing, and inseted the tubing into a special receptacle in the box.

    "What are you doing?" Park asked him.

    Juan got another box and hooked it up to the machine too. "I'm going to filter the blood."

    "Why?"

    Juan pushed three buttons and closed the panel before answering. "Godzilla's blood is extremely radioactive, and not to mention, hot. It will have melted the remains of the missile by now, and we want to get all the impurities out."

    "How long will it take?"

    "We've got about an hour to kill."

    "Well, what do we do until then?"

    "That's up to you. I'm going to stay right here. I have to make sure that nobody interrupts our work, and I have to make sure the Caine Brigade doesn't steal all the blood."

    "What do you mean 'all the blood?' Who is the 'Caine Brigade?"

    "Oh, don't worry about the Caine Brigade. It's just a name I made up on the spot. It's anyone who's working with Brandon. As for the blood, well, we can't keep all of it. They already know we have it. They just don't know how much."

    "Well, how much do we need?" Having designed the missile, Park knew that it held about 300 milliliters, about 10 ounces.

    "It depends. It would be best if we got all of it, of course, but we can't. I set the machine to give them two hundered milliliters, but you know, we should talk about something else. We don't want the Caine Brigade to bust in here while we're talking about keeping blood from them. Who knows? Maybe Brandon will have GDI bomb us with his orbital laser."

    "I should have thought of that," Park sighed.

    "No. You're still traumatized after your escapade in Japan, and the fiasco earlier. You shouldn't be expected to think of things like that. You need some time to get over it. You'll want to keep to yourself, but what you need is to talk to someone."

    "Perhaps," Park said, evasively.

    For forty minutes, they sat there. Park didn't want to talk, and though Juan knew he should, he had never been the type of person to force an unwelcome conversation on a person. After forty minutes of mostly silence, the door to the lab banged open and the person in the world they wanted to see least walked in. Brandon Caine was there, and he was flanked by Miles Fitzgerald, and two rather rough looking men who neither Park, nor Juan recognized.

    "Okay, give me the Godzilla blood."

    "It's still filtering," Juan said.

    "Really? You wouldn't be seperating some out for your own use, would you?"

    "As soon as the machine's done, you can have it." Juan maintained.

    Then, the machine beeped. Juan walked over to the machine, opened the panel, and disconnected one of the lead boxes. "Here is the blood," he said.

    One of the rough men grabbed it roughly from Juan's hands, but neither spoke.

    "Are you sure this is all of it?" Brandon asked. "What's in that other box?"

    One of the other goons with Brandon pushed his way to the machine and yanked the other box free. He shook it, and everyone heard the tinkling of metal inside.

    "Godzilla's blood melted the missile," Juan explained. "We had to filter out the garbage to have anything worth using."

    "Very well," Brandon said. "Let's get out of here."

    The goon put the box down, then walked over to the door and held it open while Miles left, but Brandon held back for a while. He wanted to get one last jab in before he left.

    "It's really sad to see that you put politics and nationalism before a matter of international importance." He sneered and left the room, followed by the second heavy.

    "Whew. That was a bit close," Juan said, after it was safe again.

    "Did you really give him the blood?" Park anxiously asked.

    "Some of it. Most of it, actually. I kept back about a hundred milliliters, just like we talked about."

    "But how? Where is it? We had two boxes, and the one we have left is filled with the remains from the missile."

    Juan said nothing, but after sticking his head into the hall to make sure nobody was spying on them, he walked back over to the machine and opened another panel that Park hadn't seen before. It was at the bottom of the machine, on the side facing away from the door. When it was open, it banged against the side of a cabinet that was next to it. Juan reached into it, and when he pulled his hands back out, Park saw that he was holding another lead box.

    "You had a secret compartment in your machine?" Park asked, incredulously.

    "Well, it does seem like that, doesn't it?" Jaun had a huge grin on his face. "But let's not waste any more time on questions. We need to hurry. What time is it?"

    Park looked at his digital watch. "It's about six thirty three."

    "I'm going to get everything set up. I have a copy of George's notes that I copied just in case something like this happened. Caine will almost certainly order the originals to be destroyed, the fact that he doesn't really have the authority to do so won't stop him. Will you grab it for me? It's the blue three-ring binder labled 'Mammoths.' It's on my desk."

    Park walked through the door at the far end of the lab. Juan had a messy office, and his desk was the messiest of all. Park rummaged through a large pile of papers, magazines, and floders, but never saw a blue binder labled "Mammoths." He straightened up and began to turn around, when he saw a stack of binders on top of the tower computer. They were all blue, so Park decided to look at the labels. They were marked as "Desert Oranges," "Tundra-enabled Wheat," and things like that. None of them were marked as "Mammoths."

    Park was beginning to become annoyed, and was about to go back and tell Juan to get the binder himself, when he saw another stack of binders. Telling himself that if it was not in this stack he'd go get Juan, Park started going through the pile of binders. Again, none of them were labled "Mammoths."

    "Where is this stinking binder?" he mumbled to himself.

    Then, he saw one more binder, sitting open on the floor, mostly behind the computer tower. Park saw that it was blue, so he pulled it out, and looked at the spine to see what it was labled. It was labled "Mammoths." Park flipped through it, but nothing much made sense to him. There were pictures and sketches of skeletons, which Park assumed were mammoths. Elephants look weird without their trunks, Park decided as he took the binder to Juan.

    "I found the binder, Juan, but it wasn't on your desk. It was on the floor behind your computer."

    "Hmm. That's odd," Juan said distractedly. He never took his eyes off of the computer screen he was typing on. "Open to page thirty-two."

    "Okay. Page thrity-two? I am there."

    "What is the third word on the second paragraph?"

    Park located the word. "Facilitate," he said.

    Juan typed the word into the computer and the screen changed. It looked like the infamous Blue Screen of Death. However, Juan did not seem troubled, and upon closer inspection, Park saw that the computer had not crashed, but only mimiced the bane of computer operators. It said:


    Project Regisaurus Options Screen

    Ctrl + Alt + Del to replace with authentic Blue Screen (Use if unauthorized persons enter)

    00832726494302384765796093272718543987u68902897127318734858927.9381785jfhey83818732
    1. Review Possible Regisaurs
    2. Design Regisaur
    3. Track Godzilla
    4. Seek Other Information Important to Project
    8. Exit
    0. Remove All Mention of Project Regisaurus From This Terminal

    997216153839127365478598216160743286y873hdjatwy47237761278489836288949003937268560

    Contact Microsoft for Technical Support or Assistance


    Juan pushed 1, and the screen changed. Another menu showed up, also designed to look like the blue screen.

    Project Regisaurus- Review Possible Regisaurs

    Ctrl + Alt + Del to replace with authentic Blue Screen (Use if unauthorized persons enter)

    0093272649324987598239806543890324987u6790342975439872347686534876243271rsaur2387743
    1. Regisaurus
    2. Poseidosaurus
    3. Cerratotops
    4. Saurotyrranus
    5. Titanotherium
    6. Back
    8. Exit

    18843285392348977543872638746213796513276578fsdue873426172839643278678645sioduoyl384

    Contact Microsoft for Technical Support or Assistance

    "What's this stuff?" Park asked, pointing to the odd words.

    "George's final plan consisted of sending five chimeral dinosaurs to fight Godzilla, remember?"

    "Yes."

    "These are the five dinosaurs. Well, they're actually four chimeral dinosaurs and one chimeral mammal." He pressed 5, and the screen changed to a black background with several 3-D models of the oddest beast Park had ever seen. It had a spikey club-tail, what looked like an armadillo shell with spikes coming out of it, a rhinocerous head with the wickedest nose spike imaginable and saber-teeth, and very long arm-like front legs that ended in very long claws.

    "That is a nasty looking critter," Park observed.

    "You were expecting a Care-Bear?" Juan laughed. "We are making these to fight Godzilla, you know." Juan hit another button, and the screen reverted back to the "Possible Regisaurs" menu. He hit 4, and the screen showed 3-D models of a nasty dinosaur. It had a huge head with huge teeth, long legs- almost like an ostich's, a bony club-tail, and very rough, thick-looking skin. The arms were very small, and not worth noting.

    Another button caused the screen to become blue again. 3 brought up the Cerratotops screen. It had the head of a Triceratops, but several long spikes protruded from the frill. It had a bony shell with spikes coming out the side, but aside from these things, the creature was obviously built for speed.

    The "Poseidosaurus" had what looked like a small horn over it's carniverous nose. It had a huge tail that was very thick at the base, but whip-like at the end. It seemed to be a quadriped, but it had long, clawed arm-like front legs that could easily reach past it's relatively short neck. He was a slugger.

    "What do you think of them so far?" Juan asked.

    "Well, they all look fairly nasty. What about the last one?"

    "George designed it. He liked it so much that he gave the project name to it. I'll show it to you, and then I'll show you the others again, if you like."

    Juan pressed the 1 button on the keyboard, and the screen once again changed to the black screen with 3-D models on it. It looked like George had put more work into this one than he had into the others. It had what looked like the head and teeth of a Tyrannosaurus. It had the signature plates of a Stegosaurus on it's back, and a tail that ended in the spiked tail of the Stegosaurus, too. It had the feet and body of a Deinonychus, one of the Dromaeosaurs, which are commonly mis-labled as "Raptors." It had thick, bony skin over it's flanks, and it had a note saying that it had "chain-mail" under the skin of it's neck, also noted as coming from a "Stego." It looked to be perfectly balanced between speed and power. In short, it looked like the perfect dinosaur to use against Godzilla.

    "Wow. He looks amazing," Park said, but then a thought occured to him. "Why are you showing me these things?"

    "Well, you have to pick which ones to make." Juan walked over to a drawer and pulled out some bones. Project Regisaur may be an "Extreme Felony" to the Global Defense Intitiative and the World Court, but it still continues. George had wanted to put you in charge if something happened, and so you're in charge even if we're not official anymore. I will give you advice, but the final call is yours. You pick which creatures we make and when to send them against Godzilla. All the calls are yours, and there aren't many people we can trust in this. Most of our people stayed with the Caine Brigade, and this Global Defense Initiative thing. I'm not sure we can trust them, and I don't think we should, especially knowing Brandon. If he finds out about this, he'll try to pull strings to have us extradited. I don't think the government will be willing to protect us if Moscow and Brussels demand our heads. No, it should probably be just us."

    Park thought for a moment. "Well," he said, "if I'm in charge now, it falls to me to alert George's family."

    "Well, yes it does, but I think that you have enough to think about right now. Deal with that later. Right now, I need you to pick a Regisaur to make."

    Park was a little perplexed. The weight of the world seemed to be set on his shoulders as a choice that may mean life or death to millions of people was plopped in his lap.

    "Show them to me again."

    Park was shown the Titanotherium.

    "Um, no. He has hair, and Godzilla has fire-breath. Bad idea."

    Juan pulled up the Saurotyrannus.

    "What do you think?" Park asked.

    "I think he's probably a bit light. He's built for speed, though he is designed to take hits.He does have good armor, though I think one good whack from Godzilla's tail might do him in."

    "Very well. Proceed to the next one."

    To the Carratotops, Juan said, "This critter is all about speed and attack. He will do no good in a prolonged fight, and was designed to kill a weakened Godzilla once the main battle was pretty much over. Not a good choice for our situation."

    Poseidosaurus looked promising to Park. "What about this guy? He is built for brawls, isn't he?"

    "He may be a good choice. My main problem with him is that he's slow. His tail isn't worth as much as you might think, though. The Paleontology Department tells me that while his tail is very strong, strong enough to cause sonic booms when he swishes his tail, he most likely wouldn't use it as a weapon, and would damage it if he did."

    "Why not put on a different tail?"

    "We have to use compatable parts. We can't isolate a gene for a particular thing yet. We have to mix the gene stuctures from different animals together. We can't say, okay, this tail, this head, and this foot. We can't be sure that what is on the screen is what we'll end up with, but it is what the computer thinks we'll get from the possible input. In effect, we tell the computer what we want, and it tells us what we need, and attempts to make it for us. This is the most advanced computer I have ever seen. Odd to think that it's Godzilla's fault."

    "What do you mean, 'Godzilla's fault?"

    "The Godzilla induced famine has spurred research into plant and animal genetics. People are hoping we'll be able to genetically engineer food that will live in harsher conditions. But on to the Regisaurus."

    "I think we should use this one," Park declared.

    "Yes. He is a good one. Shall we make him now, and do the other one later?"

    "Yes. I think so."

    "Very well. Hand me the lead box would you?"

    Park fetched the box for Juan, who inserted another line into it, and placed it in a machine that Park hadn't noticed before. The computer was on top of it.

    Park was about to ask what the machine was, when Juan handed out a paper that he'd printed out as Park was retreiving the lead box. It had the specifications for the Regisaurus.

    "Read me the specifications for the Regisaurus." Juan said.

    Park spent the next few hours reading from the lists, while Juan typed in the relavent data into the computer. In addition to what the profile had for him, Juan decided the Regisaurus should have toxic venom, something like a snake.

    The computer hemmed and hawed for a while, then it told Juan what DNA it needed put into it, and opened a recepticle to allow the input.

    "Hmph. That's odd."

    Park snapped back to reality. After he'd made the choice, he'd slipped back into his thoughts. "What is wrong?"

    "Nothing's wrong per se, just odd. I expected the computer to use Godzilla's DNA as the base creature. It wants something else. Hand me the container marked "Deinonychus."

    Park found a clear vial with the desired label. The glass was clear, but the liquid inside was gray-brown. He handed it to Juan and asked what was inside it.

    "It's a liquid containing the genetic material of a Deinonychus dinosaur. Obviously, I can't get a blood sample from an extinct animal, so I ground up a fossil to get at the DNA. Or rather, the Paleontology guys did. Or something like that. What time is it?"

    "Seven twenty."

    Juan inserted a syringe into the vial and drew some of the fluid into it. He squirted it into the receptical, and the computer closed it.

    The DNA structure came up on the screen. To Park, it looked like a bunch of gibberish, but Juan was immediately displeased.

    "Aw, man! It's incomplete!"

    "How can you tell?"

    Juan pointed to one section on the screen.


    Project Regisaur Molecule Contruction
    Current Strand = Deinonychus

    ACTGGTCGTGATGCTxATGCGTCCTGAAAAGCTxxxxCGTAGCTAAAGCTGCTGATCGAGTCGATCGAxCGATGFTGAGGGCTCGGTF=AATGCGATGCTTGCGAAGCTAxCGTGCTGATGCTAAGCTCGCTGAGCTCGATxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCGCTGAATGGCTCGGTTTCGCAGATGCTGATCGCTCGATATTGCCTTGATATGCTAxxATGCTCGCTTTGCGCGAGATGCGCGCGCGATCGGATGATxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxXGCTAGGCTCGCTCCGTCGCTTGCTCGAGATCGCGATAGAGATAGCTCCTCGCTCTCTGCGCTCGCTCTCTATATATATCGCGCGCTATAATTATCTGCGGCGCTATATATGCGCGCTATATGACTxGTCA

    "See those x's? Those are amino acids that are not in the strand. They may be filled by the other DNA strands, but the odds are against it. If they aren't, we'll have to design the dinosaur into the computer."

    "I thought it was already there. If it is not, how did the computer know to ask for this particular one?"

    "Certain features are programed in," Juan explained. "But only the parts that are set to be in the chimera. Now it wants Cobra DNA. That's odd. Must be for the toxin."

    They worked on, late into the night. Juan added DNA from several dinosaurs, not all of them the ones he expected, several insects, a couple of snakes, and after all of those, there were more, not fewer, holes in the DNA strand they were constructing.

    Juan was grumbling about this. He'd just added DNA from a Saltosaurus, presumably for the thick, bone studded skin on the chimera's flanks. "What, did we waste George's life getting Godzilla's blood? Why hasn't it asked for Godzilla's DNA? What time is it, Park?"

    Park glanced at his watch to answer the irritable Juan. "It is now one fifty-three in the morning." Park wished he had something to eat.

    "Finally!" Juan said.

    "What?"

    "It's finally asking for Godzilla's blood. Give me the lead box."

    Park handed park the box to Juan, then he sat back down, nealy tipping his chair over as he did. He was more tired than he thought.

    Juan barely noticed Park's problem. He was focused on getting Godzilla's blood into the recepticle. This was more difficult that it sounds. For one thing, being radioactive, Juan couldn't just use a syringe. For another thing, there was so little blood in the box, that it didn't want to come out.

    "At least it's cooled down now," Juan murmured.

    "What do you mean?" Park asked with a yawn.

    "It's not melting the computer equipment. I ought to have checked that before I put it in. It would have been catasrophic if it had melted it."

    Juan gave a huge yawn as the computer analysed the DNA. "Oh, boy. What time is it?"

    "Two oh-five."

    "Ugh."

    Juan kept looking at the screen, and every once un a while, he hit a button in response to a qeuestion.

    Finally, Juan said, "Park, in the cabinet behind you, there is a box with an ostrich egg that has the mother's DNA taken out of it. Give it to me."

    Park blinked. He'd almost dozed off. "What?"

    "The DNA molecule is done. Get me the ostrich egg from the cabinet behind you."

    Park got up and walked to the cabinet. He opened the door that was at eye level and looked around. "Where is it?"

    "Oh. Sorry. It's on the shelf below that one. It'll be in a box."

    Park found the box and very carefully lifted it out of the cabinet and brought it to Juan, who had taken the DNA sample from the computer and was putting it into another machine. Juan took the egg, and put it into what looked like a very thick, large CD drive. Once the egg was in it, Juan pushed a button, and the thing closed, taking the egg inside.

    "The computer will insert the DNA molecule into the egg, and then we'll be done. What are we going to do with it though? The plan was to have the Biology Department raise the critter, but we can't do that now. The Caine Brigade won't let it happen."

    "Is there anyone we can trust completely?"

    "Only you and me. We have to keep this extremely secret. We're going to have to take care of the thing, but we need a place to keep it safe. I'd take it home until it hatches, but I've got cats. The poor thing would be cat food as soon as it hatched."

    "I'll take it home then," Park said. "But where will we keep it after it hatches?"

    "We'll worry about that one later. Right now, I'm going to have the computer get rid of all Project Regisaur data, and then I'm going home to sleep."

    Park would have responded, but he was yawning. His yawn set Juan off, so when Park asked, "Why are you going to do that?" Juan couldn't respond at first either.

    Don't want one of Brandon's spied getting into it, do we? It's all on a secret second hard drive, and I'm going to have it literally fall to pieces."

    "Why?"

    "The computer people tell me that you can never really get rid of information on a hard disk. You can always get it back if you're good enough. I had one of the Computer Science people rig it up for me."

    "Do we have to stay here while it works?" Park was tired and did not want to stay any longer than necessary.

    "Nah." Juan pushed a button that opened the large CD drive thing, and took the egg out. "Do you have an empty backpack or something?"

    "Uh, no."

    "Well, you'll just have to carry it. I'll go ahead of you to make sure nobody sees you."

    Park checked his watch. "It is two twenty. Who is going to see me?"

    "Professor Burkson always comes early. And anyway, it pays to not take chances. We can't risk the Caine Brigade knowing we have an egg. Remember, I go first to make sure the coast is clear. Wait for my signal."

    "Signal?" Park asked, but Juan was out in the hall already. He looked around, but didn't see anyone.

    "Okay, come out."

    Park entered the hallway. He could see the red brick walls by the hall lights. "Why are the lights still on, Juan?"

    "They stay on all the time."

    Park looked around and saw a motion detector on the wall. He was starting to get paranoid. "What is that motion sensor go to?"

    "What do you mean?"

    "What does it talk to? Who sees us through it?"

    "Eh, don't worry about it. It just goes down to the security center, but they won't pay any attention to it. I come up here late every month or so. Not usually so late, but they'll think I just stayed late. Which is true when you think about it. Wait here. I'll see if anyone's past this door."

    They were up against a door to the outside. It was a metal door with a small rectangular window at about eye level. Park crouched some to stay out of sight, and Juan stuck his head out the door and looked around. Suddenly, he slipped out through the door and shut it quickly. Park rose a little to see out the window, but Juan was standing in front of it. Park listened and heard him talking to someone.

    "Who are you?" a strange voice called out.

    "I'm Juan Saiz. I'm a geneticist here."

    "You got ID?"

    "I do."

    There was a delay, then, "All right, Mr. Saiz. What are you doing here at two o'clock in the morning?"

    "I was working on something that needed to be done tonight.

    The person said something that Park couldn't quite make out, but after a while, Juan came back in and told Park to come on out. Park came out and asked Juan what had happened.

    "Oh, a yellow-shirt showed up and started asking questions."

    "Security Guards aren't usually that aggressive, are they?"

    "Bah. It was that new guy. He's always suspicious."

    They walked toward the parking lot, pausing only for a car when they needed to cross the street. At last, they reached the parking lot.

    "Whew. I feel better now that we're here," Juan declared.

    "Yes. We have made it this far without being caught, but it will be hard to keep a dinosaur the size that this 'Regisaur' will grow to a secret."

    "Yeah, well, we'll deal with that when it comes. For right now, go home and keep that egg safe."

    With that, Park opened the door to his Ford, got in, and drove home.


    Read Stardate 5438 at KaijuGalaxy now!


    Posted Image


    FFKT TOKENS: 15
    Offline Profile Quote Post Goto Top
     
    Zardac the Great
    Member Avatar
    Light Side Sith

    The next morning dawned and Park stayed in bed. This was unusual for him. He liked to be early for everything, and getting up was included in that. However, two things kept him down on this particular morning. One was that he was tired. After all, he had been awake until about three o'clock the night before. The other thing was that once he had woken up, he'd once again retreated back into depression over the recent events in Japan. It wasn't like Park to do that, but these hadn't been ordinary events.

    Park didn't make a habit of getting close to people. He generally kept his feelings to himself, but George had been different. There had been something about him. Part of it was that they shared hatred of both Godzilla and the Communists. But now that Park thought about it, George hadn't exactly hated either. It was more of an intense anger. George was extremely angry at Godzilla, or had been rather, for the pain, misery, and death he caused. He had been angry at the Communists too, for the same reason, and had frequently pointed to the Soviets' atrocities in Korea in arguments with various people. This had endeared him even more to Park, who though he was an American, still felt some attachment to the land of his ancestors. There was just so much to think of, and he could not make sense of it all. He also felt himself becoming close friends with Juan, but he was not sure what to think about that.

    He tried to make himself stop thinking about everything that had been going on, but he couldn't. He tried to make himself get out of bed, and after a while he succeded. He went to the kitchen to fix something to eat, but he didn't feel up to it. Nothing sounded good anyway, but he was hungry, so he microwaved a sausage biscuit. He decided that he would feel better after a shower, so he walked to the bathroom and took one. Afterwards, he dried off and got dressed. Then he remembered his sausage biscuit, so he walked back to the microwave in the kitchen. His breakfast was cold, so he heated it back up. Thirty seconds later, it was too hot, so he decided to let it cool down some before he ate it. He put it down on the counter and went off to watch the news. As he walked into the room, however, he saw the egg sitting on his couch.

    Then he remembered. He was supposed to be watching the egg! And he'd just left it sitting on the couch! What if it fell off? Juan had said that there was no more Godzilla blood. This was the last chance they had! If something happened to the egg, it was all over! George would have died in vain! No, Park decided, the couch was not a good place for the egg. He pushed it into a corner of the couch and surrounded it with pillows to keep it from falling. Then he went looking for a box. At first he thought a cardboard box might do, but then he decided that they were too flimsy. He wanted a plastic box about two feet high. He didn't have one. He wasn't sure where he could get one, but after some thought, he decided that a small trash can might work.

    He went shopping for trash cans. Instead he found a storage box with a detachable top that had a swinging flap on it. He bought it and took it back to his home. He took the top off, put a blanket in it, and wrapped the egg up in the blanket, leaving the top part uncovered because he'd heard that some eggs let air pass through, and he didn't know if ostrich eggs were one of those. He put the box in his living room, so he could watch it as he watched the news. Then he remembered his sausage biscuit. It was cold.


    ***

    Nothing much happened for the rest of the week. Godzilla hadn't been seen, and though he had an astounding heat signature, no satilites or aircraft or any such device could locate him. The Global Defense Initiative was declared as being an official standing army for the United Nations, answereable only to the UN Secretary General and it's actions could only be overridden with a unanimous vote from the UN Security Council, which given the fact that the Soviet Union and the United States were both on it, that wasn't likely. Besides, the UN was pretty much only an international "yes-man" group to the Soviet's activities. The Soviet's latest advancement was in Mexico, where a civil war was underway between the Socialists and the Mexican government. The Soviets had put a resolution forward in the UN for a "Peacekeeping Action." The Soviet ambassador had made it clear that if the Americans vetoed this action, as they had for the last ten, the Soviets would be "forced to call a vote on continued American presence in the Security Council." The White House had chosen to abstain, but was calculating the risk of sending troops to prop up the Mexican government now against the risk of doing nothing while the Soviets obtained a forward base at the US-Mexico border. A volcano errupted in Indonesia, and a new Intifada had started in Israel. East and West Germany were holding another round of re-unification talks.

    At least, nothing much happened as far as Park was concerned. The egg had not hatched. To the rest of the world, it was another hectic week in a hectic world. To the Americans, it looked like the world was finally falling apart. To the Soviets, well, nobody really heard much about what the Soviets were saying. Most people were sure, however, that the Soviets were very pleased with the way things were turning out.

    At least Juan was. Unlike Park, he had been paying attention to what was going on in the outside world. He was a bit worried about Park, not having seen him since seeing him off with the egg. He picked up the phone and called Park.

    "Won Park."

    "Park, this is Juan. How are you doing? I haven't seen you for a while."

    "Oh, I am okay, I suppose. How about you?"

    "Hmm. I'm all right. I was just worried about you. Haven't seen you for a few days, so I just thought I'd check up on you."

    "I am fine."

    "You don't sound fine, but whatever. You tell George's family yet?"

    "Oh. No. I have not. I'd better do that right away."

    "You know who they are, and where they live?"

    "Um, no. The only thing I know about George's family is...is...I guess I really do not know anything about them. He didn't talk much about them."

    "Do you think they go to the church we went to? It's in the next town north, and aside from his classes and Godzilla, I don't remember George talking about mujch else."

    "What is today?"

    "Today is Saturday. Go up there tomorrow, and see if they can help you at all. You know where it is?"

    "Yes. George asked me to go with him many times, but I never did go."

    "Well, go up there tomorrow, then I'll see you on Monday."


    ***

    Park got up late again on Sunday. He'd been getting up late ever since he'd brought the egg home. He got showered, got dressed, got breakfast, and then, after checking the egg one last time, got in his car and drove off.

    He showed up at the church about half way through the sermon, and was shown to a seat by a smiling usher. Park was suprised. He'd expected the usual ornate building with stained glass and pews. He'd expected a minister in ornate robes with a choir loft behind him. He expected crosses and crucifixes and paintings of saints or something like that. Instead, it was a store front with white walls, fluorescent lights, and metal chairs. It held about a hundred people, and the only decorations were some plastic plants, a bulletin board with photographs, and a map with pins in it. He listened to the Pastor talking, and was a little suprised there too. He was mainly talking about how Jesus had died on a cross so that people could be forgiven for sin. Park thought it was interesting, but wasn't sure what to make of all of it. He generally left religion to theologians.

    It didn't last very long after Park got there. He'd been later than he'd thought. The Pastor gave people an invitation to come forward and pray, to ask Jesus to forgive them. Park didn't go; he decided he wanted more information and didn't have time to get it right now. Afterwards, he was practically mobbed by people wanting to know who he was, and basically get to know him. He got several invitations to lunch, but he said that he could not come, but thank you anyway. Finally, he found the Pastor, he was a jovial person with graying hair and a deep voice, and asked him about George's family.

    "You're with the anti-Godzilla people, aren't you?"

    "Um, not anymore. How did you find out about that?"

    "George told us. I assume he died in Japan?"

    "How did you know that?"

    The Pastor sighed and looked a bit sad. "He was warned that if he went to Japan, he would not be coming back."

    "Well, yes. He did die in Japan, but in doing so, he set in motion events to save many lives."

    "That's good. But why are you trying to find his family?"

    "I'm trying to tell them about what happened."

    "Well, I don't know. But you see that couple over there?" He pointed out a couple who were organizing their children. "They knew him, and they know his family. They'll be able to help you."

    Park went over to them and explained the situation. They were saddened at the news, but agreed to tell George's family what happened. His mission accomplished, Park went home.


    ***

    When he got there, he heard a cracking noise and tiny little shrieks. He rushed into his living room to see the egg hatching, and a little head sticking out. It saw him and shrieked at him. Park ran to his phone and called Juan's cell phone. He told Juan to get out of whatever he was doing at the time and high-tail it to Park's place. Then he hung the phone up and raced back to the egg.

    The little dinosaur was almost out of the egg when Juan showed up, banging on the door. Juan could only think of two reasons why Park would give him a call like that. Either the egg was in trouble, or it was hatching. From the excitement in Park's voice, he decided the thing was hatching.

    As soon as Park answered the door, Juan asked, "Is it hatching?"

    "Yes it is! Come in quick!"

    But Juan was already inside, and by the time Park got back to the egg, the dinosaur was up and about. Park, who was crouching down, watched it explore it's environment, sniffing everything, biting at a roach that had snuck in during Park's week of inaction, looking at the coffee table and the door. It rubbed up against Juan's leg, then leaped onto Park's shoulder, which threw Park's balance off, making him fall backwards. The tiny Regisaur sensed the sudden change in the angle of his perch and jumped off onto the floor. When Park sat back up, against the wall, the chimera jumped back on his shoulder and rubbed against his face, before jumping off once again and scampering into the kitchen.

    "Boy, that is one ugly chimera." Juan commented, watching the dinosaur sniff around.

    "Really? I find him rather cute."

    The dinosaur was about four inches tall, but both of them knew that would change. Juan turned on the kitchen light and they saw the dinosaur's coloration well for the first time. He was mostly tannish, but with some purple scales- especially down his back and tail. Every once in a while, there were some scales that looked to be pearl colored. He almost seemed to sparkle as those scales caught the light. His hind feet had very stubby versions of the "Raptor Claw" that signifies a Dromaeosaurid. His tail had very small, stubby spikes at the end. His smooth back turned a bit rougher over his flanks, and his Tyrannosaur head had no teeth.

    He was very energetic, as Park and Juan found. Soon, they had been to every room in the place, and all the lights were on, and they humans were growing tired from following the chimeral dinosaur everywhere. As the dinosaur scampered around, eventually dumping a trash can to investigate the contents, Park turned to Juan.

    "What shall we call him?"

    "Well, George said that it was a Regisaurus."

    "That works fine for a species name, but look at him! He is full of personality. He needs a name."

    "Hmm. I'm no good at naming things. Any suggestions?"

    "I can not think of anything right now."

    They watched as the baby jumped onto a counter top in the bathroom. He crouched down in the sink.

    "What was it you called him earlier?"

    "What? I don't remember calling him anything."

    "You said that he was an ugly something."

    "Oh. I said he was a chimera. A human made monster, generally one put together from different parts of other creatures."

    "Well then, he's a chimera. We should call him Chimerus."

    "Chimerus. I like it. But where are we going to keep Chimerus now that he's hatched? One week seems like an extraodinarily short time to spend growing in an egg, and I saw a thing on dinosaurs that said an Allosaurus grew to its full height in nine years. We have no idea how fast this thing will grow, but we need to take him there while he's small. Once he's as large as a big dog, it's too late."

    Park looked a bit dissapointed at this, so Juan said, "He can't stay at your place forever, Park. He's going to be about the same size as Godzilla. Do you think we can keep him a secret if you have a dinosaur the size of a Tyrannosaurus Rex in your living room?"

    "No. Where shall we keep him?"

    Juan thought about that. "Is there any place to keep a gigantic chimera alive and secret?"

    Park thought for a little bit. "The Grand Canyon?"

    "I don't think so. Too many tourists, not enough food, and he'll surely show up on spy satilites. You know the Soviets and Euros are going to be very interested if he pops up on one of their satilite scans. What we need is a big, covered place, like a big cave, or something. It has to be somewhere where we can bring him food, and we have to be able to find a way for him to get water."

    "What about the college sports arena?"

    "Yes! That would work very nicely. He'll be cramped towards the end, but nobody's used it for years, and he'll be hidden away from any prying eyes."

    "We should take him there now."

    "Okay. You grab him, and we'll go in my car. We should make sure nobody's coming first though."

    "Should we bring any food for him? He should be hungry by now, don't you think?"

    "No. He should still have a fair ammount of egg yolk in his stomach. He'll be fine."

    Park reached down and hoisted up the scampering Chimerus. He'd expected the dinosaur to start wriggling around, trying to get free, but instead he just relaxed into Park's arms. That was when Park noticed two things about Chimerus.

    Juan came back in, announcing that no one was coming, and it was safe to go.

    "Look, Juan. He's smiling, and he's bigger."

    "Well, what do you know? He is smiling. He's got lips." Juan was very suprised.

    "He's bigger too."

    "I think that's your imagination, Park. He probably won't get noticeably bigger for a week or so. But let's go."

    Park carried Chimerus out to Juan's car and got in. By the time they'd gotten outside, there was someone there, but it was a jogger who had already passed Juan's car and had their back to them. Chimerus had let out a little shriek at the person, but Park thought that the person's MP3 player must have drowned out the noise. At any rate, they didn't react to it.

    Once they got into traffic, things were a little more tricky. There were other motorists around, and if Chimerus poked his head up, or jumped over the seat back, he would be seen, especially if it happened at a red light. Park put Chimerus in the floor-board in front of him, and tried to push Chimerus down without leaning forward to obviously.

    As they pulled around to the side of the sports arena where they couldn't be seen from the street, Park said, "You know? For the first time in my life, I find myself wishing that I lived in a less friendly part of the country. One where people do not look at you."

    "Well, you don't. You live where almost every driver not only looks at you, but makes eye contact with you and waves at you."

    "I know. There is no point in wishing for what we do not have, is there?"

    "Nope. Let's go in."

    They found an old delivery door that they were able to pry open. They took Chimerus in, shut the door as best they could, and started looking for the light switches.

    "We should have brought a flash light." Juan grumbled.

    "The lights for this room will most likely be on the other side of the room," Park stated. "I think that the door we came in would have been opened by a person already in the building. The light would already be on when the driver got here."

    "Yeah. I'll go open the-OOF!"

    "What happened? Are you all right?"

    "Yeah. I ran into something hard. It got me right in the stomach. I'll go open the door a little to let some light in."

    Park chuckled a little. "Be careful this time."

    "Yeah yeah yeah. Here we go."

    The door opened enough to let some light in, and Park quickly turned on the lights and opened the door to the rest of the arena. Aparently, Chimerus was tired of being held. When the door to the rest of the arena, he started squirming around. Park told Juan to shut the delivery door again, and set him down. Chimerus scampered off to explore his new home.

    "How well can he see in the dark, Juan?" Park asked.

    "I have no idea. But however well he can see, we need lights. Let's find the switches to turn the lights on."

    Non-use takes it's toll on a building. As they found light switches one by one, Juan and Park found cracks, missing tiles, broken glass, and the like. Some lights had fallen down from the ceiling. Rats and spiders populated the lower level. A Raquetball court by a basketball practice court seemed to have a corpse of some sort in it. The smell kept them from entering.

    On the whole, they had a good time in the arena, for one reason. Chimerus was there.

    Chimerus was full of energy, and he'd often go running by the humans, sometimes leaping onto their shoulders, sometimes brushing by their legs. He'd terrorize the rats if he found one in the open, chasing it and filling the air with his little shrieks. He never caught one, but neither human were sure if he was trying very hard. Several times he could have bitten one, but hadn't. Or at least, that's what it looked liek to the humans. It could have been that he was just young and inexperienced.

    "Hey, Juan. How are we going to feed and water Chimerus?"

    "Well, I'm not sure. Food will probably not be a problem for a while. He'll just catch rats and things like that. Once he's bigger, or the rat population has decreased, we'll have to bring him food. Eventually, it will probably be cattle, which is a bit scary. Cattle are both stinky and expensive. I'd suggest you start saving now. As for water, it will probably have been cut off to this building, but we should check. Otherwise, we need some pretense for having the water company turn it back on."

    "How likely is it that the water will still be on?"

    "Not very likely, but like I said, we should check. If there aren't any leaks, the water company just might have forgotten to turn it off."

    They started walking towards a restroom to try the water.

    "How are we going to get him to drink though?"

    Juan laughed at that. "I think that's fairly instinctual," he said.

    "I mean, are we going to just cut a pipe? If we started a flood in here, the water company would definitely notice and shut us off."

    "I don't know. For a while he could drink out of toilets I guess. It's not like they've been used these last ten years." Juan tried a sink. "Yep. The water works."

    "Really? That is good, but he is not going to be this size forever. What about when he is bigger?"

    "Park, you worry too much. You never used to worry, why are you starting now?"

    "Park thought about it, but didn't like his answer, so he gave a half-true answer. "Maybe it is because it's our last, best chance in the fight against Godzilla."

    "Hmm. Well, we'll take care of that when the problem shows up. We probably won't need to worry about it for quite some time."

    They were about to leave the restroom, when they found that the doorway was blocked. Not by a person, or a chimera, but by a large rattlesnake.

    It saw them and started shaking it's rattle. They thought that if they didn't move it might leave, but instead of leaving, it came closer to them.

    "I think we're in trouble," Juan remarked as they backed away.

    They backed past several stalls, but they knew they could only go so far before they hit a wall.

    Then, Juan, who'd always been afraid of spiders, backed into a web and hollered, causing the snake to rear back and lunge. Park narrowly avoided geting bitten. Neither one was feeling lucky enough to avoid getting bitten again, but the snake turned around. It had felt vibrations in the floor and wanted to know what was coming. When it came through the door, the humans recognised it at once. It was Chimerus! He'd heard Juan's holler and had come to investigate.

    "This is bad," Juan said.

    "No worse than you shouting and making the snake try to bite me!" Park retorted.

    "No, it is a lot worse. What if it kills Chimerus?"

    "Well, there is nothing we can do. The snake is between us."

    It was. The humans could only stand and watch, hoping against hope that the snake wouldn't kill Chimerus. They didn't have much time to think on this though, because with a battle cry that was a lot lower than his usual shrieks, Chimerus darted towards the snake.

    The snake coiled up, triggered it's rattle, and lunged toward Chimerus, hoping to poison whatever the odd thing was before it. Chimerus, though, leapt out of the way, his feet brushing the serpent's nose as he did. Chimerus hunkered down, wanting to test the reflexes of his foe before he truly threw himself into the battle.

    The snake lashed out again, but Chimerus had spaced himself well, and was just outside the snake's reach. The snake noticed this, and uncoiled to scoot forward. Chimerus leaped to the left as the snake struck at his right leg. Chimerus was up against a wall now, and couldn't back up, but he'd seen that the snake tensed up ever so slightly immediately before it attacked. On the other hand, the snake noticed that Chimerus was up against a wall. It lashed out and would have bitten his enemy if Chimerus hadn't jumped onto a sink above them.

    Not being able to blink it's eyes, the snake had seen Chimerus go up, but couldn't see where he actually was. The movement of the humans attracted it's attention, and it hissed as it slithered towards them again. It was the type of opening Chimerus had hoped for. Filling the air with his low battlecry, he pounced onto the snake's back, biting it's neck with his toothless mouth.

    Park would have thought that not having teeth, the snake might have ignored Chimerus' bite, but that bite hurt the snake immensely. Even toothless, Chimerus' T.rex jaws had an immensely powerful bite, and it was crushing the snake's vertebrae, and his toxic, corrosive saliva was burning through the snake's scales.

    The snake thrashed around wildly, desperately trying to knock Chimerus off. Eventually, it knocked Chimerus against the pipes to the sink he'd jumped onto earlier, stunning him long enough to lose his grip. The rattler was quick to follow up with another strike, but Chimerus had already scampered away, expecting just such an attack.

    The snake looked around until it found Chimerus, who for the first time had his mouth closed. He was looking at the snake, and made no movement as the snake slithered closer. Chimerus saw the snake tense up to strike and opened his mouth to give a little sneeze. The humans would have thought it was very cute if it hadn't had such drastic effects.

    The snake had actually been in mid-strike when Chimerus' sneeze met it. It drew back mid-strike, instantly writhing as it's head started disolving. When it was all done, only a bloody half-snake was left. Chimerus sniffed the snake, gave a shriek, then crawled under the dividers into one of the stalls. Park opened the door and saw Chimerus smashing eggs in the toilet.

    "Well! That snake must have been guarding a nest!" Park declared.

    "Either that, or it had just laid the eggs."

    Either way, Chimerus had defeated a fully grown rattle snake, and he was making sure that it wouldn't have any prodgeny.

    Suddenly, Juan yelped. A spider from the web he'd backed into had just run over his face. He kept yelling and swatting at it while both Park and Chimerus watched him, and though he didn't mean to, Park couldn't help laughing a bit. He didn't mind spiders much and he was relieved that he wasn't dead, and even more so that Chimerus wasn't dead.

    Chimerus on the other hand seemed to not think too much about his victory. He rubbed up against the humans' legs like a cat would, then left to continue his exploration of his home.

    "What t-time is it, Park?"

    "Oh it's about eight o'clock. Why?"

    "I think we should go now. And anyways," here Juan gave a shudder, "I've got a very bad case of the creepy-crawlies." They climbed the stairs to the top floor, and noticed something. It was starting to get dark, and they had left the lights on the top level on. That meant that anyone who drove by would be sure to see inside. They rushed to turn them off, and were irritated when they found there was no way to keep Chimerus downstairs.

    "Let's just hope he doesn't go outside," Juan grumbled.

    At last, they had the lights on the upper level out, and they felt their way to the delivery door they'd found, and once they'd convinced Chimerus he had to stay inside, they went to Juan's car and drove off.


    ***
    Read Stardate 5438 at KaijuGalaxy now!


    Posted Image


    FFKT TOKENS: 15
    Offline Profile Quote Post Goto Top
     
    Zardac the Great
    Member Avatar
    Light Side Sith
    The next day, Juan and Park went back to the old Arena, but this time at night, and with flashlights. They had rather expected Chimerus to meet them at the door, but thought that he must be downstairs romping around.

    However, Chimerus wasn't romping around downstairs. Chimerus was waiting for the humans upstairs, hidden in the shadows, waiting to pounce. As soon as he saw the shapes, he jumped onto the one closest to him, landing with his hands on Juan's shoulder, his feet trying to dig into the flesh at the bottom of Juan's ribcage. Park shined his light at Chimerus just in time to see his mouth open, now it had little teeth which he was about to sink into Juan's neck. Park's first impression was that Chimerus looked angry. He was wrong. Chimerus was in a full rage.

    Park quickly grabbed Chimerus, putting one of his hands under Chimerus' jaw to keep from being bitten, and said, "No, Chimerus. You can not eat Juan."

    Hearing Park's voice brought Chimerus to his senses. These were his friends. He'd mistaken them for the other people. He melted into Park's arms and stopped squirming, but Park was afraid to let him go, because he didn't know if Chimerus would attack again. He eventually set Chimerus down and jumped back, afraid that Chimeus would turn around and bite him, and he knew what his saliva could do.

    However, Chimerus didn't bite. He walked a few paces, then turned around, looking at them, and giving a little shriek, just like he wanted them to follow him. Neither were sure they wanted to go with him, especially after the welcome he had prepared for them, and they had noticed something that shocked them. Chimerus now had little Stegosaurus plates on his back, and little Stegosaurus spikes on his tail. His feet had miniature, but perfectly developed
    "Raptor Claws." Chimerus was definitely growing up. Park thought he looked a little bigger too.

    Chimerus ran back to them, got behind them and tried to push them forward, putting his head on their legs, then he ran forward again. This time they followed him.

    He led them through the cinderblock hallways and past one of the practice basketball courts into a room that connected the two hallways.

    "This was the old equipment room," Park commented. There were flat basketballs, decaying jerseys, other assorted sports equipment, and to Juan's great disgust, spider webs galore. He decided to wait outside while Park followed Chimerus into the dark room of shelves.

    Juan saw Park crouch down and shine his light at something, but he couldn't tell what it was. "What's that you've got threre, Park?" he called.

    "I am not sure. It is very odd. Chimerus showed me some holes. They are all the shape and size of his new plates, but I can not think of what they could be."

    Well, we should get some water turned on for him," Juan decided.

    "Yes, I think we should. Come on Chimerus."

    Chimerus wasn't as energetic or excited as he had been the day before. He stayed very near the two humans as they all walked towards the restroom again.

    "Juan, what do you think has gotten into Chimerus? He is not acting like he did yesterday."

    "Yesterday was the first day of his life. Everything was new and exciting. He's probably just gotten used to everything."

    "I do not know. I think something must have happened."

    "Maybe he was a little angry that we left him alone."

    "Maybe."

    They entered the restroom and looked around for a good place to pool water for the little chimera.

    "He jumped up on top of the sinks last night. Le'ts see if we can stop up the sinks. Anyway, they'd be better than having him drink out of the toilets."

    "Hmm. That would be good." Park tried the sinks. Two of them leaked slowly, but the third held all the water they'd put in it. Very rusty water it was too. It had been too long since those sinks had been used. That was why when Chimerus jumped up on top and leaned over to drink, Juan grabbed him and pulled him away.

    "Park, unstop the sinks and run good water into them."

    There was no need to tell him though, Park was already draining the sinks and had the taps running at full blast. Eventually, all the rusty water was gone, and the sinks were filled with clean water.

    Okay, put him down."

    Chimerus jumped back up and leaned over to drink again. He'd barely gotten his jaw into the water when he lost his footing on the wet porcealin and fell in with a shriek and a splash. The humans couldn't help but laugh at the sight, but then Juan noticed that Chimerus' plates had changed color. When he had fallen in, they had changed from their reddish-brown to a palid yellow, and then to a deep, blood-red. Park grabbed the dinosaur out of the sink and Juan filled the sink back up, but noticed that Chimerus' plates had turned to a green, and then back to a reddish-brown as he was put down again.

    "Park, his plates change color."

    "What?"

    "His plates change color. Right now, they're brown. Earlier, they were red."

    "This is very interesting. Chimerus is a chameleon?"

    "Well, his plates are at any rate."

    "We should probably go now, Juan."

    "Yes. We should."

    "I don't want to though. I'd rather stay with Chimerus."

    "If you go missing again, it's going to raise questions. You need to go home and go about your usual activities."

    "Yeah. We need to go."


    ***

    Time passed, and even Juan had to conceed that Chimerus was growing at an extremely fast rate. Whether it was something in his DNA from the quick growing Allosaurus and the huge Sauropods or something else, neither could tell. Within two months, Chimerus was the size of a fully grown man. He had also eaten almost all of the rats, snakes, and spiders that inhabited the arena. That meant that the humans would have to start bringing in food for the chimera.

    "Juan, where have you been this last week? I think we have a problem." Juan had just showed up at Park's door for the first time in a week.

    "Really?" Juan barely succeded in holding back a laugh. He put on a sarcastic voice and said, "I never would have guessed. Who knew that cows were this expensive?"

    "It is more than that. We're still in a bit of a famine. Hopefully we're at the tail end, and America is doing better than most, but the government will be watching. If they notice that we are buying thousands of cattle, they will investigate. Either you need to find a way to genetically engineer and feed a food source for Chimerus, or you need to tell the government and try to get their help."

    "What do you mean I have to tell the government?" Juan was a little irritated at this.

    "I mean that you are the geneticist. If you tell them, you can say Chimerus is an experiment of yours, and you can tell them how you made him to fight Godzilla. You might be able to convince them to protect him and feed him."

    "I don't think we can trust the government. I think we might be able to convince the current President, but what about after the next election? I don't think that any of the people who are likely to get elected will have the guts to stand up to the UN about him, and the person I think most likely to win will be eager to follow the UN."

    "Then you need to find a way to genetically engineer food for him. I suggest you get a grant to buy a field, grow some of your genetically engineered wheat or something like that-something that grows quickly and preferably year round- and grow cattle that grow quickly and don't need to eat much."

    "Ther'es only so much I can do with genetic engineering, Park, but for once, I'm a step ahead of you. Remember your first question? You asked where I had been for a week? I now own a sizeable plot of land that has been sown with several different varieties of my wheat and corn. All of them have been designed to grow year round and to live on small ammounts of water. They're all experimental, but as soon as they start producing, I'll intoduce my re-engineered Mammoths. The government and the public have been told, truthfully I might add, that it's part of an experiment to grow more food to help end the famine. I told them that the experiment utilized brand new techniques and technology. In fact, it's also part of Project Regisaur and they helped me get everything set up to create Chimerus. Until winter we need to buy cattle, but I found a way to claim they were part of the experiment, and thus they come to us courtesey of Uncle Sam."

    "Wow."

    "Yup. So don't worry so much. What I worry about is how we'll continue getting Chimerus water. He won't be able to drink from the sinks much longer."

    "I have that figgured out. We need to take my car this time."

    They drove to the arena in Park's car and when they got there, Park had Juan help him bring in pipes.

    "What're these for?"

    "To help Chimerus get a drink."

    Chimerus came bounding up to them once they left the delivery room. he sniffed the pipes and was very interested in what they were doing, but eventually, he left and started scampering around the arena again, just as happy and full of energy as he'd been on his first day there.

    "Did it look like his claws were a bit bloody to you, Park?"

    "Well, he is a carnivore. I wonder if he caught a stray cat or dog."

    "Maybe."

    They took the pipes into the stands of the actual main court, where the college basketball team had once played games. There was a torn banner half laying on the floor and half still hanging from the ceiling that read "GO GREYHOUNDS!" One of the scoreboards had fallen and broken on the ground, the other seemed to hang on by the skin of it's teeth. about half the lights worked, and the seats were covered in cobwebs. They put the pipes down and Park got a ladder that he'd previously brought. He put it down between rows of chairs and extended it so that it reached the ceiling.

    "Park, what are you doing?" Juan shouted.

    "It is like you said," Park said as climbed. "Chimerus ca not keep drinking from sinks. This place has sprinklers that spray water if the building catches on fire. I am going to tap into that and make something for Chimerus to drink from."

    "You can do that?"

    Park looked down. "I can design a rocket that draws Godzilla's blood then blasts off again, waiting to be picked up and you think I can not design something to let Chimerus drink?"

    Park had already shut the water off to the pipe, so very little water came out when he opened the pipes. He saw that what he was planning wouldn't work with those pipes. He needed something somewhat larger. He climbed up into the ceiling, and started connecting the pipes to the main water pipe to the building. He connected pipes down to the top level of bleachers, then connected another one that was larger to it just below the ceiling. The actual mechanism was a huge version of what is used to give a hampster water. It had a pipe coming down with a large ball bearing. When Chimerus wanted water, he'd lick the end, thereby pushing the ball bearing back and letting water through.

    "Why do you have two of them, Park?"

    Well, until he is nearly fully grown, he will use this one. When he is too large to use this one, he can use the one on the ceiling. We should probably show him how to use them."

    Chimerus was very interested in the new contraption, and quicky found that he could cause a spill by poking the ball bearing.

    "Well, I guess our water bills will be going up." Juan remarked.


    ***

    Godzilla was bored. He'd been all over Japan, searching for any survivors or any remnants of the evacuation. Then he'd done it again. And again. And again. Godzilla was sure that Japan was totally unpeopled. Even the plants were dying out from his radiation. He'd tried smashing the few remaining ruins of the Japanese civilization, but with nobody to kill, no fighter jets desperately trying to buy time for the people to run away, nobody screaming in terror, it just wasn't the same. That was why he'd decided to go up north. He'd never been to any Soviet city, and Vladivistok had a base for nuclear submarines. It had been nearly a decade since Godzilla had eaten, and he was getting a bit hungry.

    The Soviets must have heard him coming. Whether it was from an anti submarine sonarbouy or a geiger counter, Soviet ships were streaming to meet him. A shiver of excitement went through Godzilla's spine. At last, combat, death! Should he blast them now, or should he draw it out, surfacing and letting them see his face before he killed them?

    He decided to draw it out.

    He rose to the surface next to a Soviet battle cruiser, ignoring their puny weapons. He raised his head out of the water and stared into the Bridge of the ship, seeing the captain panic and the whole crew there run for their lives. Then he bit down on the bridge and dove under the surface, bringing the ship with him. When he was a good way under, he used one claw to rip the ship bottom. Then he felt several torpedoes explode against his sides. The torpedoes were the only weapons the Soviet fleet had that could damage him at all. Each one was like a paper cut to him, and the pain angered him.

    He felt the heat rising in his throat as his spines started glowing bright blue. On the breath he had left, he sent out a stream of blue plasma, vaporising the nose of the submarine that had shot him, and superheating the air and water in and around the submarine. The crew died from the extreme heat.

    Godzilla surfaced for a breath, making sure his spines ripped into another surface ship as he dove back under the water. He spotted another Soviet Akula submarine with it's torpedo tubes open, about to fire again. The torpedo came, ejected from the tube by compressed air, and Godzilla rose a little, just enough to miss the torpedo, which started following him. Then he went back down, behind the submarine, and was gratified to hear the explosion telling him that the Soviet torpedo had killed the submarine that had launched it.

    When he surfaced again, he saw that the remaining Soviet destroyers had launched helicoptors after him. There were three of them, and they moved slowly. They had been looking for him under water, and so were flying low and slow. Godzilla vaporised two of them with his breath, which blinded the pilots of the third. He snatched that chopper with his hand and threw it into one of the remaining Soviet ships. It penetrated into a magazine and the whole ship went up in a fireball. He vaporised the middle of one of the ships and watched as the bow and stern sank seperately, then he grabbed the last ship and just dove under the water holding it. He wouln't destroy the ship, he'd just hold it there, underwater listening to the cries of the crew until they stopped, then he'd eat the reactor the ship held.

    Yes, he was going to enjoy Vladivostok.


    ***

    The next day, two headlines flew everywhere. The first was that Godzilla had flattened Vladivostok and the Soviet Naval base that had been there. That meant that a very good portion of the Soviet Pacific Fleet had been destroyed. Analysts were theorising that as much as a third of the Soviet nuclear capacity had been neutralized. More conservative estimates set the number at around one fifth.

    It also meant that the Americans might be able to pull off a blockade of Mexico and central America, thereby cutting supplies off to Soviet troops fighting in the civil war in Mexico. The President had announced that several South and Central American nations, including the Mexican government, had asked for American involvement. It seemed that though they weren't too fond of the US, the Soviet invasion had scared them, and they prefered a peaceful neighbor they didn't care for than an invader from the other side of the world.

    In short, it meant that American troops would be fighting in Mexico.

    Not all Central American nations were happy about it, though. Venusuela had been "brought into the Leauge of Soviet Nations" quite some time ago, as had Cuba." Both had troops in Mexico.

    Europe was a little slower in responding. A spokesman for the EU said "While we definitely conceed that the United States has a right to look after it's own interests, it cannot do so in opposition to UN mandates. The UN has decided to intervene in the civil war, and the Americans must accept that. We find the charges made by the US President that the Peace Keeping Operations are thinly veiled Soviet Invasions to be completely without merit, as forces from many nations such as Cuba, Poland, China, and Spain are present. If the United States feels that there have been some irregularities in the execution of the intervention, they should bring it before the UN Security Council, not try to settle the matter on the battlefield, and especially not in a battle with UN forces."

    The campaign took a long time. The American's set up a naval blockade of the area of operations, thereby cutting the UN troops off from supplies. Venusuela could only supply a small ammount of troops for a short period of time especially as an alliance of South American nations invaded them on the way to join the fight against the Soviet-led multinational forces. However, not all the fighting was done south of the US border. Bombers came from over the arctic circle to rain death on US cities, and what was interesting about those bombers was that though they were mostly Russian bombers, they had no national markings on them. Instead, they had a silver circle with the gold sillouette of a hawk swooping in on it's prey. It was the symble of GDI, the Global Defense Initiaitve.

    "This is a FOX News Alert."

    Park was at Juan's house and they had the news on. Congress had started the draft again, and either one of them could get drafted at any time if the situation got bad enough. The only good news any of them knew of was that Caine was keeping his head down. All of a sudden, when GDI bombs started falling on American cities, the citizens of the United States decided they really didn't like the UN too much. Juan had been working overtime with his geneticly engineered foods project, both because Chimerus was now larger than a Tyrannosaurus rex, and because the government needed food for the troops. He also thought that if he made himself too valuable to draft, he might not be drafted.

    "GDI, US, and Allied forces seem to have fought the final battle in Mexico today. US officials are calling it an unparralled victory, and the most bloodless of the war. According to US Army General Phil Downs, the blockade resulted in GDI forces literally running out of the supplies necessary to continue fighting. The President has ordered all Soviet forces captured into POW camps, while any and all non-Soviet forces who were essentially drafted into GDI at the beginning of the war are to be returned home in good faith.

    "This just in, we have a report that the Panama Canal has just been destroyed." The screen showed footage of the remains of the canal, with smoke and fire everywhere. "We are now joined by our military analyst, retired General Joe Black. Joe, why would GDI find it necessary to destroy the canal?"

    "Well, Bob, the canal is, or I should say was a very strategic point. It let US and Allied naval forces move quickly between both oceans. Most US naval forces are in the Atlantic. It may be that GDI is planning an invasion on the western coast of either US or Allied territory. On the other hand, it may be that GDI is hoping that the US and Allied navies do hurry and go around the tip of South America so that they can land on the eastern side of the continents, or they could be doing it to limit future American and Allied mobility. There are any number of reasons for them to do so."

    "Sorry to interupt, General, but we also just got word in that NORAD is asking us to report that there is a new wave of GDI bombers approaching both the Northeast and Northwest portions of the county. If you are in these portions of the country, seek shelter immediately. These bombers are nuclear capable, repeat, these bombers are nuclear capable, though no Weapons of Mass Destruction have been used so far in this war. Just so you know, we are broadcasting from our bomb shelters at FOX news, so you aren't going to see us incinerated on live TV."

    Juan looked at Park. "I don't think they'll drop many bombs on them anyway. Once they see the bombers, they'll launch Raptors. Anything that makes it through has to deal with Patriots and F-15's."

    "Are there enough Raptors to do the job? I heard the manufacturing plant got blown up."

    Of course there aren't enough, but the Raptor's a good plane. Not one of them have been shot down since the begginning of the war. Can't say the same for the F-15s."

    The war went on, and Chimerus grew. As the war went on, both humans payed less and less attention. An American ship was destroyed here, GDI bombers launched missiles there. American shipyards and manufacturing plants were being hardened against attack. England was still making everybody mad, becuase they were unwilling to fight the Americans, but they were also unwilling to fight GDI. The Allied navies were unable to stand up to GDI's navy for the most part, but it wasn't uncommon to hear reports of a daring raid on a Soviet submarine base, or of Allied gunboats swarming a GDI battlecrusier and then scattering. The effect of Allied hit and run tactics on the high seas and ports led to GDI developing their own version of a gunboat, one loaded with missiles, for GDI's specialty was heavy weapons.

    Juan and Park didn't devote too much thought to such things. They were beginning to get worried about Chimerus. He was getting big. Neither were sure he would stay in the arena for much longer. He now filled pretty much the whole room containing the main court. He was still full of energy, but he was no longer happy. He was cramped. He was still pleased to see Juan and Park when they showed up, but he complained the whole time.

    "I still do not know how you manage to bring so many mammoths here and nobody notices, Juan."

    "I don't. I tell the people up there that I take them somewhere else to run more experiments. In town, I tell people who notice that I'm running a top secret experiment here."

    "You let them know that we are doing something here?!" Park was suprised.

    "Well, yes. We got found out, and I had to come up with an excuse. I told the police department that it was dangerous, and that's why they posted a guard around the building."

    "I was wondering about that." Park grumbled.

    "Well, don't worry. The police make sure that nobody is allowed near the building. The city wasn't happy that I appropriated the building without telling them, but with the war, and trying to bring the police up to military fighting standards, they didn't really have the time or will to stop me. Hey, Chimerus!"

    Chimerus grunted at them as he saw them. Then he whined a little at having to stay in such a small area. It had been about a year since he'd been really comfortable, and he didn't think he could take it much longer. He turned and grabbed a mammoth carcass to eat, but in doing so, he knocked some more off of the already damaged wall.

    "I am getting worried. Chimerus can not stay in here much longer, but is he ready to be outside? He's lived here his whole life. Will he be able to stand up to what is outside?"

    "What do you mean, Park?"

    "Well, Godzilla for one thing. He has had next to no combat experience, and even before that, he may have to fight either the American military or GDI."

    "I think he'll do well against any military. Once he gets out, we'll definitely see. I'm not sure if we can call the military off. I'm more concerned that he'll wipe our military out, then GDI will just swarm right in. As to Godzilla, well, he was engineered specifically to fight Godzilla. He did all right against the snake, so I think he'll do okay."

    Chimerus sensed that they were troubled over something. He gave an unhappy grunt and took a drink of water.

    "Yeah, we know, big guy. We don't like it either."


    ***

    Read Stardate 5438 at KaijuGalaxy now!


    Posted Image


    FFKT TOKENS: 15
    Offline Profile Quote Post Goto Top
     
    Zardac the Great
    Member Avatar
    Light Side Sith
    The next evening, just as the sky was turning dark, and the third and fourth stars were appearing, Park was walking on the sidewalk across the street from the old arena. He thought he heard a crunching coming from the arena. It wasn't loud, and when he didn't hear it again, he resumed his walk. He thought he heard it again, and again he stopped.

    He had a nasty feeling.

    Slowly, Park fished out his cellular phone and called Juan.

    "Juan, this is Park. Something is going on at the arena. I think you need to be here."

    "I'm on my way."

    Juan came running out of the red brick building just behind Park about two minutes later.

    "What's going on?" he demanded.

    "I do not know. Listen."

    They heard nothing but the cars that were passing, but when they passed, they could hear a creaking and a crunching.

    "Oh! We need to get the policemen away from the arena! Chimerus is coming out!"

    "There's no need for that Saiz, they're already gone," a most familiar and loathed voice said.

    "Caine!" Juan and Park both said through clenched teeth.

    "Oh, you remember me, huh? I wasn't sure if you would. I'm a little suprised you didn't recognise me sooner, you've seen me since you left, but a makeover can work wonders."

    Indeed, Brandon Caine looked little like his old self. He'd shaved his long hair and grown a gotee. Instead of his former attraction to light colors, he now wore all black.

    "What are you doing here, Caine?"

    "Well, you are in a lot of trouble," he guestured toward his two heavies. "You might not have known it, but my two commandos- yes they're former Spetznatz but the Soviets graciously allowed them to join GDI, which by the way, is my creation, my commandos have known what you were doing since the night you took your precious little chimera into the arena. You see, that's where we were planning on assembling the Ion Cannon. You know it as the Orbital Bombardment Laser, but we quickly gave up on the laser idea. Very inefficient for our purposes.

    "If you remember, I warned you that GDI was going to have a problem with your little genetic engineering plans. It was a mistake, I admitt. If you had used your brains a bit, you would have realised what was going to happen. I was worried you would alert the US government, but luckily Juan had heard rumors of such a thing and thought it was common knowledge."

    "What's your game, Caine?"

    "Game? Oh, it's not a game. You see, my plans have been set for a while. Godzilla presented me with an opportunity. If I could get rid of Godzilla, I would be thrust into a position of power and authority, but Godzilla avoided the Black Hole Bomb, and you two and George stopped me from trying again. I didn't care much for that route anyway. It was my backup route. I'd already been talking to the Soviets. I convinced them to expand their territory a little more on this side of the Atlantic. I argued that Africa offered nothing to them, that they needed to take the United States. I told them that the easiest way to take the US would be to take Mexico, so they would have a land base from which to launch the invasion. If the US could be egged into attacking UN forces, all the better. I plotted with the Soviets to create a standing army for the UN. The Soviet ambassadors made the US afraid to veto it. Since it was my idea, they let me be in charge, secretly. Though now, I'll be the official head too. Kind of ironic, isn't it? Caine in charge of GDI?"

    "What are you talking about?"

    "You don't know? Well, it doesn't matter. You two are in trouble, and so is your creation. GDI is about to use it's Ion Cannon for the first time." He turned to his two commandos. "We'll use the Ion Cannon on the arena, then shoot them. I'm going to walk away a little so that the shots don't hurt my ears."

    The commandos forced their captives into the shadows and held guns to their heads. They saw a blue light growing in the sky, and by it's light they saw small GDI logos on the sleeves of their uniforms. The light grew and became a line in the sky, streaking down and growing larger as it came, then it hit the arena, turning it to rubble and setting fire to the remnants. Park was sure Chimerus was dead, and he was sure he was about to die. Was there really an afterlife? He didn't have time to think much on this though, as from the rubble a blue beam shot back out, throwing rubble around and causing an explosion in the sky. It had apparently hit the source of the first beam.

    The commandos were so suprised they forgot to shoot.

    Then, everybody's feelings were altered at once by a loud shriek, and the appearence of a huge Tyrannosaur head from the rubble of the stadium. With another loud shriek, Chimerus climbed out of the ruins of the arena. The commandos dropped the pistols they'd had at their captive's heads and pulled out high power submachine guns. They unleashed thousands of rounds while they rushed at the creature. When they saw just how big he was, they stopped in their tracks, stareing.

    Chimerus was stareing at the two of them too. He recognised them. They were the two scum who had kicked him around and left him for dead on his first night! He roared his low battle cry and pounced towards them. They tried to run, but they had no chance of outrunning him. When he came into the light, Park saw that his plates were a deep blood-red. He grabbed them with his mouth just as they reached the door into the building. He swallowed the scum who had hurt him along with the brick and glass of the building, then he roared into the air as loud as he could. It shattered glass for a quarter mile around him.

    Chimerus looked around him, and saw Juan and Park rushing out to see him. He bent down, smiling, but then he heard a couple of jets screaching overhead.


    ***

    Two F-16 Falcons from a nearby Air Force base had been getting in some training hours in the area. They'd tracked cars and semi trucks with their air to ground radar and infrared systems- after making dead sure their weapons were inactive. Then, they'd seen a really large, blue laser shoot from the sky, then they'd seen the same blue laser shoot from the ground to the sky. They decided to have a look, and they saw an incredibly large lizard erupt from the rubble left by the laser.

    Base, this is Lone Ranger. We have a situation in the town."

    Roger that, Lone Ranger. What type of situation?"

    "Base, we just saw a dinosaur bust it's way out of the ruins of the sports arena."

    "Say again, Lone Ranger?" It was the base commander this time.

    "Base, the sports arena was destroyed by an orbital laser of some sort, and a dinosaur came out of the ruins."

    "Can you get us a visual on that, Lone Ranger?"

    "Roger that sir. Visual coming up."

    "Lone Ranger" flipped on a visual targeting system and transmitted the feed to the base as he and his wingman circled the dinosaur. Upon taking a closer look at the situation, it looked like the dinosaur had cornered two people, who were waving and screaming for help.

    "Lone Ranger, you are weapons free. Take that thing down!"

    "Yes sir. This is Lone Ranger, closing in on one ugly dinosaur by the old sports arena. Do you have laser lock Tonto?"

    "Me have bad guy, Kemosabe."

    "Fire your Mavericks."

    The two planes had been going to use their Maverick air to ground missiles on a simulated bunker just before they returned to base, but instead they launched them at whatever that ugly creature was below them.


    ***

    Chimerus saw the missiles coming at him. He knew he could dodge them, and he was aware that he didn't know how powerful the projectiles were. For all he knew, they could kill him.

    He also knew that if he moved, they would hit the two humans who had helped him. He stood his ground.

    Juan and Park were terrified and angry at what had happend. Juan assured Park that he thought that if he had designed Chimerus right, he shouldn't be hurt.

    Park caught only the uncertain terms Juan used. Both were angry at the military. Hadn't those pilots seen them trying to wave them off? That didn't matter now though. They ran as hard as they could to try to get away from the missiles. They had all of two seconds before the missiles hit.

    The night errupted as four air to ground missiles hit Chimerus. He was nearly engulfed by the flames, but when the flames cleared, Chimerus still stood, unscathed. He opened his mouth and roared his defiance, but the F-16's were returning to base, as their only remaining weapons were Sidwinder air to air missiles and a machine gun. Neither pilot thought such light weapons would work where the ones meant for the job had failed.

    Chimerus looked around. Juan and Park were safe, some of the grass and trees around him had caught on fire, the burning light from the sky wasn't shooting anymore, he was hungry, and he was free! The urge to explore, his old energetic, happy curiouness came back, after being unable to explore for a three years, and unable to move around for a year, Chimerus was free in the great outdoors. There were places to go! There were things to do, and Chimerus wanted to see it all! He bent down and grunted his thanks to Juan and Park, and then, he ran, for the first time in three years, Chimerus ran!

    He suprised himself at first. He wasn't used to being free, but however much he suprised himself, he suprised the towns people far more. Some cars were accidentally trampled by the wobbly Regisaurus, and others ran into each other as their drivers stared at the impossible creature before them. The only destruction that Chimerus purposely caused was when he came by a supermarket. He smelled meat, and he brought the place down getting to it.

    Meanwhile, as Chimerus was trashing the town before he left, Park and Juan had a very unwelcome guest.

    Brandon Caine came back up to them. "Very good, you two. Round one goes to you, but don't worry. We still have the plans, and we'll rebuild the Ion Cannon. Next time, we'll use it on American forces. I think you'll find that will cause the American people to see sense and surrender to the inevitable. I'm rather dissapointed in your wisdom, Park. When you haven't taken your Tae Kwan Do lessons for ten years, you shouldn't assault a master," for Park had rushed Caine and been quickly thrown onto the pavement.

    "Well, I'm sure you two will see more of me, though I doubt I'll see more of either of you." With that, Brandon Caine walked away, and left the two others to nurse Park's bloody nose and lip.

    They went to Juan's house to try to stop Park's bleeding and get a war update. Allied engineers were buisily trying to rebuild the Panama canal, but were being harried by GDI fighter bomber raids from Cuba. Their antiquated anti-aircraft guns, while a lot better than nothing, were not adaquate air defense for the GDI MiGs, Eurofighters, and Sukois. The United States shiped Stinger shoulder launched Surface to Air Missiles, but they weren't nearly enough. The US had launched hundreds of Tomohawk crusie missiles into Cuba, but somehow, GDI managed to keep enough operating airfields to harrass the Allies and keep rescources bottled up in Florida. American air forces kept pounding away and-

    "This is a FOX News Alert. We just recieved word that an Allied force has landed in south-eastern Cuba and is currently involved in heavy fighting. Joining us by phone is Brazillian General Rico Salvador. General, thank you for joining us. Can you explain what this is all about?"

    "There are many things I can not speak of due to operational security, but I will tell you what I can. First off, I will give the reason for this war. In Brazil, we are constantly bombarded with propaganda telling us that we are in the wrong because we are fighting the United Nations. In reality, we are fighting Soviet Aggression. The Soviet Union has shown up to now that it is an imperialistic power, first they took Asia in the wake of Godzilla's attacks. They now rule a series of Asian puppet states. In Africa and the Middle East, they invaded one nation at a time, sometimes under the cover of a UN "Peacekeeping" Operation, and sometimes without. Recently, they invaded Mexico. Let us be perfectly frank. The Soviets want Mexico so they can have a springboard into the United States. Once they have America, they will surely come South. In short, we are fighting for our homes and our freedom, the same as in the American Revolution. We have no wish to be ruled by a bloody foreign dictator. Our Alliance is made up of our countries. We are not the pawns and toys of dictators in Moscow. We have our dissagreements witht the United States, but we are willing to fight alongside you in the face of mutal danger."

    "Well, we can appreciate that General. May we ask you a question?"

    "You may, but remember that I might not be able to answer."

    "Up until now, Allied forces have avoided full scale battles for the most part, and have relied on speed and stealth. Can you tell us the reason for the change in tactics, and what it might mean?"

    "I can tell you that the GDI forces in Soviet controlled Cuba have made themselves a menace to our people, and Allied High Command has decided that they must be taken out at all costs. This is not a war of conquest, this is a war of liberation for the Cuban people who have suffered brutally under a dictator who turned a nation that was once the envy of Central America into the pit of filth it has become, and it is a war to protect our people, and in doing so, we will help protect the American people too." A large explosion was heard, and then General Salvador said, "I must go!"

    Juan flipped to CNN, which was at commercial, then the picture went to snow, then the face of Brandon Caine filled the screen. "Hello," he said. "I am Caine. I am the leader of the Global Defense Initiative. I just thought that you, the American people might like to know the truth about your government's actions as of late. The American government told you that the various governments of the Alliance asked for American intervention in Mexico. Well, that is true, but what they didn't tell you was that they threatened the Allied leaders with nuclear annhialation if they refused." The screen showed a mushroom cloud, then went back to Caine.

    "Your government also told you that GDI was bombing American cities, and they show expertly done computer graphics of American fighters fighting desperately to shoot down the evil GDI bombers before they reach American cities. In reality, the bombers are American bombers that the US military has repainted in GDI colors. "The screen switched to a warehouse that showed a bomber with American markings being hurriedly repainted with GDI markings. "GDI wouldn't bomb American cities. It's your own government, desperately trying to get your support for an illegal and immoral war. And just so you know, here is footage of American troops in action in Mexico."

    The screen showed American troops laughing as they shot civilians and called an airstrike down on a group of POWs.

    "I know the American people won't stand for this. This is not who most of the American people are. I urge you to rise up against your oppressive, deceitful government and join GDI! Bring a new America into the fold as a true citizen of the world!"

    And with that, the screen returned to snow, then CNN. The anchor apologized for Caine's speech, and said that they were trying to track down where the hacker was who had taken their satilite. Juan and Park were disgusted by Caine, and didn't want to hear him anymore, so turned off the television before he could do it again.


    ***

    The next few weeks had war news interspersed with the story of Chimerus "rampaging" through the countryside. It seemed that Chimerus was heading mostly west, with little adjustments to the north and south periodically. Juan and Park, and indeed everyone who watched the news, saw footage of Chimerus domolishing a dairy here and there to eat the cattle, or dodging missiles, but coming away unscathed when one hit him.

    "You know, Park, we should call the government and tell them about Chimerus and Caine."

    "Yes. We should."

    "Who do we call?"

    "I don't know. Ghostbusters?"

    "I'm serious, Park."

    "The FBI probably. I do not know for sure. Maybe the police?"

    It was decided that Juan would call the FBI, after he got the number from the police.

    After getting through the computerized menu system, Juan was on hold for what seemed like an eternity, then his call was taken. The operator was rather uninterested (Caine sightings were fairly common amongst the agitated populace) until he mentioned that he was the one who had actually created the dinosaur currently ramaging through the country. The operator suddenly became very interested, and got his name and address. The person seemed to ignore what he said about Chimerus, but was very interested in who and where Juan was. Within a few minutes, and before Juan was off the phone, his house was surrounded by police cars.


    ***

    Chimerus had never been to a large city before. His wanderings had taken him around most of them. Something was drawing him west, but it wasn't so strong as to draw him in a straight line.

    Now, he was in Denver, and he saw something he'd never seen before, skyscrapers. He had seen buildings as tall as himself, but only from a great distance. Now, he was walking among them. Then, he stopped. He saw something that looked just like him. It was mimmicking every move he made. When Chimerus raised his head, so did the other one. Chimerus closed one eye, and the other did the same thing. There was something about this that Chimerus did not understand. He wasn't sure what, but something was wrong. He sniffed the air, and did not smell any other creature like him in the area. He shrieked a call to the other one, and it caused the glass of the skyscraper to shatter. Startled, Chimerus bit the structure in reflex, then stopped to analyse the situation.

    There were people inside the building! Chimerus saw them now that the reflective glass was gone. They were terrified and were screaming as they tried to find a way out of the building. Some were blown out of the building by winds and fell screaming to the pavement below. Sirens blared, and police and National Guard soldiers tried to repel the beast, but Chimerus didn't notice the bullets striking him. They were simply too small, and his scaley skin was too hard.

    Then he heard a ­thwok-thwok behind him. He spun around and saw four AH-64D Apache Longbow helicoptors closing in on him. He watched them, interested. The helicoptors scattered, trying to present smaller targets, some heading around buildings to try and flank the dinosaur.

    Then, one of the pilots made the unfortunate decision to fire at Chimerus.

    Chimerus ducked under the Hellfire missile, but the chaingun tracked him, doing little, and the second Hellfire slammed into Chimerus' T.rex head. Chimerus' plates turned a deep blood red and the pilot had no time to avoid having their machine crushed in the gigantic jaws. Another Apache fired, hitting the base of Chimerus' tail, resulting in Chimerus spinning around, knocking his spiked tail into a building, causing it to crumble on a third Apache trying to sneak around him. Chimerus pounced on the offending Apache, and spying the fourth, gave chase.

    "Sir!" the remaining pilot screamed into his headset. "The target's chasing me!" He turned his Apache through a gap between buildings. "He's already killed the other three, and I think he's going to get me!" Another road, another turn. "Send help!"

    But help came too late. Chimerus had stayed right on the Apache's tail, and with a mighty roar, had bitten down on the choppers' tail, sending it crashing to the ground, spinning. Then, once again feeling the pull west, resumed his trek.


    ***

    The police questioned Juan and Park until the FBI could get some agents over to them. They got there about five in the afternoon, and both were flown to Washington, where they were questioned extensively by FBI agents.

    "You say, Mr. Saiz, that you are the one who created this 'Chimerus.' Genetic engineering, I presume?"

    "Yes, sir. I did."

    "And you helped him, Mr. Park?"

    "I did."

    "Tell me, for what reason did you create such a monster?"

    "To fight Godzilla, sir," Juan replied.

    A shiver ran down the spines of many of the people in the room, but their interregator continued.

    "To fight Godzilla, eh? You think that sounds really good, don't you? You wanted to make a monster that would weaken us in a time of war, and you thought making it to fight Godzilla would sound like a good excuse!"

    "What? No, I-"

    "Shut up!" the agent interrupted. "Watch this!"

    The lights dimmed and a video appeared on a screen. It showed Juan and Park directing Chimerus in a rampage, having him go out of his way to stomp on a day-care, and then trample a nursing home. It stunned them into complete silence for a while.

    After the shock of what they had seen wore off, Park said, "The only thing I can say about that is that it is not true."

    "You're right," their interregator said. "It's not. We traced the transmission that this came from, and it definitely came from GDI. Someone over there decided they don't like you."

    "It's Caine," Juan said.

    "Caine!?" the agents shouted.

    "Brandon Caine," Park said.

    Juan continued, "Caine worked with us in the anti-Godzilla group back home. In case you don't know, we were sanctioned by the government. Caine came into leadership, and dropped a Black Hole Bomb on Godzilla, but I guess he missed. We worked in the shadows to create a giant chimera to fight Godzilla, but we got found out and had to rush. Caine went to work both on an Orbital Bombardment Laser, which he called the Ion Cannon when we last saw him, and a poison gas that he said was to be designed especially for use on Godzilla, but I wouldn't put it past him to develop a super virus or something to wipe us out."

    "Why is that?"

    "Well, the Ion Cannon was supposed to be used only on Godzilla too, but he used it on Chimerus. He also said he would rebuild it and use it on American troops."

    "What do you know about this Ion Cannon?"

    "It seems to be a spaced based weapon, so it's on some type of space vehicle. It has a blue light, and it fully destroyed the arena we had Chimerus in, but then it seemed to bounce back up and destroy it's launcher."

    "It did? Do you know why?"

    "Um, no sir," Park replied.

    The agent who had been interregating them sighed.

    "If you don't mind me asking, sir, if you knew that we were innocent, why were you acting like you were so sure we were guilty?"

    "I never said you were innocent. I only said that we knew the video came from GDI. As things are, it's a little late to do anything about it. Does this Chimerus recognise you two?"

    "Yes, sir. He does."

    "Does he like you?"

    "He seems to. Why?"

    "Oh, I'm just thinking. Never mind."

    The agent walked to the other end of the room and confered with the other agents. They spoke in low voices that neither Park nor Juan could hear, but their conversation was interrupted by a voice over the intercom and a siren blareing outside..

    "Warning! GDI Cruise Missiles appraching! Find cover immediately!"

    Everybody in the room went pale, but nobody as much as Juan and Park. They had been handcuffed to the chairs.

    "Let us out!" they both started yelling as agents ran away. One of them undid the handcuffs as quickly as he could, then pushed them through the doorway and down the stairs as quickly as they could go. They literally sprinted down the stairs until they reached the basement, but before they did, they heard explosions outside.

    They waited below ground the rest of the day.


    ***

    "This is CNN Breaking News." The underground Emergency Newsroom at CNN was abuzz. People were running around, taking latebreaking news items to anchors, working the phones to find experts to come on the air, people combing the AP and Reuters wires and the internet for any scrap of news. It was chaos, but it was very controlled chaos.

    "CNN is now reporting that there has been a simultameous strike on several places in the United States. While we gather more details, here is CNN reporter Diana Hodges in Washington. Diana? What can you tell us?"

    The rather frightened reporter was out in the open. The rational behind this move was two fold. She had been outside when the attack started, and it seemed that the attack was only missiles. They would have a pre-programmed target, and it was likely that the places most likely to have a bunker would be those most likely to be targeted.

    Still, it didn't make her feel any safer.

    "Frank," she sounded decidedly shaken, "About five minutes ago, missiles started blowing up buildings here in Washington. I don't know if the White House and Capitol are still standing, but it's safe to say that they're targets."

    A convoy of military vehicles rushed by, not paying any attention to the reporter on the ground.

    "As you can see, the military is rushing to do what they can, though I'm not sure what that might be."

    She covered her ears as another missile streaked overhead, plowing into some building or another, raining debris down on the terrified civilian population as they desperatley ran for their lives.

    As she started to speak again, the camera caught a man, dressed in black and carrying a sub-machine gun. He had a small white GDI logo on his sleeve. There was no way she could have known it, but as the CNN reporter reported on the cruise missile attacks, and as any CNN viewers watched, a GDI Commando saw that he was being filmed, and fired his weapon at the camera.

    "Diana? Are you there? Can you hear me?" The Anchorman and his crew had no luck in getting through to the reporter.

    "Well, keep trying to get ahold of her. Meanwhile, Washington is not the only US city under attack. New York, Boston, Orlando, and Camp David are all under heavy attack, mainly from missiles."


    ***

    By the end of the day, more was known. The Pentagon was confirming that GDI Commandos had raided under the cover of the missile strikes. The White House had been the first target, and when they had found that the President wasn't there, they had rigged it with explosives and demolished it. Raiding the Capitol had been more fruitful for the Commandos, as seventy five members of Congress had been executed, their bodies flung outside of the building before it too was demolished. Camp David was a harder nut to crack. The commandos had met with a contingent of Navy SEALS, and the two groups had fought it out. Five SEALS had died, while seven Commandos had died. It seemed that nobody had been wounded.

    In addition to government and military installations, GDI had targeted restraunts, churches, parks, and had even apparently taken out civilians. More than a few bodies had been found, not only dead, but mutilated. It was seen as a message: Stop fighting, or you're next!"

    And to top it all off, as if everything else wasn't enough, at ten the next morning, sirens announced trouble to the citizens of Los Angeles.


    ***

    Godzilla stood up out of the water in the bay and roared. It rang like a bell and ended with a honk. His back started glowing, and he swept his beam across the bases of the buildings by the docks in Los Angeles. The bottoms vaporized, and the buildings came crashing down.

    Godzilla walked up onto the concrete shore. He was walking erect at the moment, but he could change that whenever he wanted to. For right now, he wanted to terrify these puny people with his shere size. He walked into the city, waving his tail around on the ground behind him, in case he had missed anything or anybody.

    Soon, the military showed up. The first were the Apache helicoptors. They buzzed around him firing their puny weapons. They had no weapons that could even peirce his skin. He changed his posture to that of an ordinary dinosaur. This brought his tail up, almost to the same level he held his head at. The pilots didn't see this, and a casual flick of his tail sent several of them to the ground in flames.

    The tanks arived next, but they were far beneath Godzilla's notice. He stepped on a few, but ignored their feeble efforts to curb him.

    Then he saw a woman holding a baby. She was running away. It would be fun to kill her, he decided. He saw her run down a side street, desperately trying to get away. He walked through a building in her path and looked right at her. She started running the other way. He saw where she would go, and rushed over to come out in front of her again. His lips drew back into a grin as he saw her running into an alley. He walked into it after her, shattering the buildings as he went. He caught up to her in in a few seconds, and was pleased to hear her scream right before he smashed her with his foot.

    Then, he caught the scent in the air. The scent that had brought him from Japan. He had forgotten about it momentarily, but his nose told him that somewhere east of here was another. But this other was an abomination. It smelled of not just too many different smells, but different kinds of smells. It was obviously one creature, but it smelled like three. It would have to be crushed.

    Godzilla turned from his destruction of this city. The other was coming, and he wanted to meet him in an untouched arena. That would prove interesting.

    Godzilla left the city to live another day. He returned to the bay. Maybe a submarine or two would show up to challenge him. You never know.


    ***

    Chimerus felt the other one was near. He felt it in his bones. It felt...it felt like a wave of evil. Chimerus sniffed the sky. The creature smelled vaugely like himself, but in his bones, he knew that this thing was different. Maybe it would recognise that Chimerus was like it. Maybe they could be friends. Then Chimerus remembered the feeling in his bones, and he doubted that the other one would be the kind of creature that Chimerus would want to get along with.

    A contingent of Apaches and Hummers were closing in on Chimerus, who was standing still as he contemplated this other being he felt. He noticed the closing vehicles and sprinted forwards and to the right. He'd seen vehicles with the marking these bore fight vehicles with the hated swooping bird circle of those who had hurt him as a baby. He would not hurt them if he could help it. He ran past them and dodged their missiles, catching only one stinging Hellfire at the base of his tail. He had to get to the other one.


    ***

    Still in the underground bunker with the FBI agents, Juan and Park watched the footage of both Godzilla in LA and Chimerus in southwestern Nevada.

    "Do either of you have any idea where Chimerus is going?" and agent asked.

    "I am betting that Chimerus is heading for Godzilla," Park said.

    "I think you're right. It might have something to do with Chimerus having Godzilla's DNA inside him," Juan theorized. "I'm not sure how it can be that, but I can't think of any other reason he'd be going like he is." He turned to an agent. "Is there anyway you can get us there?"

    "We can. We've been shuttling troops from the west to the east because the bombing has mainly been on the east. We think that the bombing raids, with the exception of yesterday's, have been an effort to soften us up for invasion. The question is, do you really want to risk it? So far, we've been able to keep GDI aircraft out of the interior of the country, for the most part. But you never know what can happen in a war, and anyway, LA is being evacuated. There will be nobody there to help you when Godzilla shows up."

    "We know. We want to go."

    "Then we make this request. If at all possible, when GDI invades, try to get Chimerus to attack them."

    "We'll try."


    ***

    It turned out that the airports had been hit by anti-airstrip missiles with bomblets designed to crater runways. They had to be driven to a small, private airstrip several miles away. The troop transports had been destroyed during the attack, so the government started chartering small airplanes to move troops around out of small runways. It was on one of these that the duo had to ride in. It was a long ride.


    ***

    Chimerus arrived in an evacuated Los Angeles. He was suprised to see no people, and he had figgured out that his reflections on the buildings were just reflections. He felt in his bones that the other was near, he just wasn't sure where. He sniffed around the huge city, trying to find the other one.

    Eventually, he got to a part of the city, near the bay, where buildings had crumbled, and things had been smashed. Surely this had been caused by the other one.

    He bent down and sniffed. He'd found a trail! He followed it until he came to a park. It had trees, but was mainly open and flat. Then he saw two huge faces, higher that his, across the park. One was a reflection on a building, but one was real. Chimerus sniffed, and his nose told him that this was the one he had followed. He opened his mouth and gave a shriek. How would the other respond?

    Godzilla was partially hidden among the buildings, so he advanced a little. He was roughly sixty meters tall, bent over as he was, a good head and shoulder taller than Chimerus. He opened his mouth and the smallest hint of his roar came out, followed by a growl.

    Chimerus, who had been standing tall with his head held high was easily over-awed by the monster king. He decided that he couldn't intimidate Godzilla, so he should get ready in case Godzilla chose to fight. He crouched down and placed his hands on the ground, ready to pounce with all his power. His plates turned to a palid yellow color.

    Godzilla saw the movement and attacked! He lit up his spines, and stood upright, slamming his tail onto the pavement. He opened his mouth and exhaled a beam of plasma on his breath.

    Chimerus saw the blue glow and hopped to the left, landing as Godzilla shut his mouth, and throwing himself at Godzilla with his raptor feet outstretched and his T.rex mouth open.

    Godzilla saw Chimerus's leap and spun around, pushing his body down and his tail up. His tail hit Chimerus and threw him into a building, causing it to collapse upon itself. Godzilla felt the heat rise in his throat as his body stripped the electrons off of air molecules and he exhaled the plasma into the dust and rubble. He waited for the dust to settle to see what damage he had delt his foe. When it did settle, he saw no sign of Chimerus. He lifted his head towards the sky and roared his victory, but his eye caught movement behind him. He had not the time to turn, however, as Chimerus was on him! He had leaped up and onto a building when he had landed, and as Godzilla roared, Chimerus had pounced on his foe with his claws outstretched.

    The next thing they knew, they were both screaming in pain.

    Chimerus' leap had staggered Godzilla, and his claws had ripped open Godzilla's sides, but Godzilla's jagged spines had ripped open Chimerus' chest and belly. Both hit the ground, bleeding, but both were soon back on their feet, but Chimerus had taken the worst damage.

    Godzilla was infuriated. The new creature had done something that Godzilla had never had happen to him. Nothing had ever ripped Godzilla's skin, much less dug into his muscle! The strange hybrid would definitely die. As Godzilla stood healing, he charged up his plasma breath to fry the abomination before him.

    Chimerus saw it, and though he was healing, knew that he did not want to get hit by the blue light on his open wounds. As Godzilla sent the plasma out on his breath, Chimerus crouched and turned his side towards Godzilla.

    Godzilla had aimed high, trying to vaporise Chimerus' head, but instead, he hit Chimerus' Stegosaurus plates. The military Predator overhead saw what happened, but nobody else did. The military had imposed a total media blackout, and with Godzilla's reputation for sniping news helicoptors, nobody complained too loudly.

    The blue flame charred Chimerus's plates, but not as badly as it should have. Instead, the plate absorbed the plasma, and it dissapated amongst the other plates, then it all concentrated at the largest plate on the side towards his enemy, then shot back at Godzilla! It hit Godzilla and staggered him back. His sides were still healing, and now his chest had been burned too. He roared his fury and charged at Chimerus, who had his side turned to Godzilla, his feet and hands on the ground, and was waving his spiked tail around threateningly. His plates were now a deep blood-red.

    Godzilla essentially tackled Chimerus. Ignoring the Stegosaur tail spikes Chimerus had buried deep within his side, Godzilla tried to sink his razor sharp teeth into Chimerus' neck. However, they didn't get much past the skin. One of Godzilla's fangs snapped as it came into contact with Chimerus' bone chain mail under the skin of his neck. Godzilla let go of Chimerus' neck, but as Chimerus slashed at him with his Deinonychus feet, Godzilla tore at Chimerus' chest with his claws, then rose to stomp on Chimerus, trying to crush his rib cage.

    Chimerus bit out at Godzilla's foot, and managed to latch a hold on it, causing Godzilla to try to jerk back, not only from the pain of Chimerus' teeth, but from the pain of Chimerus' toxic, corrosive saliva. The poison wouldn't hurt Godzilla, his high body temerature would denature it before that happened, but it was wearing away at his skin. He tried to shake Chimerus off of his foot, and eventually, Chimerus let go. One of Godzilla's claws had jabbed the inside of his mouth.

    Godzilla was in a rage. His spines started glowing their near-white blue, but it didn't gather in his mouth. Instead, through his many wounds, Godzilla's Nuclear Pulse errupted. It did damage on it's way out, ripping bits of flesh out with it, but it knocked Chimerus into the building behind him, and he stopped moving. Then Godzilla turned his attention to the two humans he'd seen come running up.

    Juan and Park had seen Godzilla's previously unknown Nuclear Pulse blast Chimerus away. They were shocked to see him die like that, but right now, they were more worried tht Godzilla looked like he was coming after them now!

    Godzilla was indeed coming after them. They could see in his eyes that he meant to kill them, too.

    "Split up!" Juan yelled.

    They ran in different directions, hoping to find a subway entrance or some other place to hide. It soon became obvious that Godzilla was chasing Park. Park spotted a subway tunnel entrance, but Godzilla's nuclear breath put an end to his plans of going there. Park spotted an alley and sprinted down it. With a boom! Godzilla was right behind him, and Park could hear the buildings crumble behind him.

    Odd thoughts started going through Park's mind. He wasn't as terrified as he expected himself to be, he was becoming curious. Was this what had happened to George? What about his double from another dimension? What if George had been right about God? Was there really a Heaven? What about Hell? One way or the other, Park was sure he was about to find out. He was in decent shape, but Godzilla was faster than a human. Park decided that it must be Godzilla's long legs.

    Then, a familiar low roar filled the air, and Godzilla hit the ground on his side. Chimerus was there! As Park ran away, Godzilla stood to face the crature who would dare challenge him again. He stood upright, to his full one hundred meters or so and roared at Chimerus. Both had nearly healed from the wounds they'd given each other. Both were worn out, but both were still ready to fight.

    Chimerus opened his mouth and gave what sounded like a sneeze. It covered Godzilla in his corosive, burining saliva, and started eating away at Godzilla's skin. Soon, Godzilla's wounds were open and bleeding again, as he charged Chimerus. Chimerus jumped back, into a building, which collapsed upon him. Godzilla advanced, ready to tear out Chimerus' guts with his claws. He reached Chimerus, knocked him back down and ripped through Chimerus' skin with his claws.

    Chimerus screeched in pain, and his legs kicked spasmotically, knocking one of his huge raptor claws into Godzilla's shoulder, throwing the monster king off of him. Chimerus stood to his feet, bleeding. He might have the same healing capacity as Godzilla, but he'd lost a lot of blood, and being smaller, he couldn't afford that as much. He needed a plan fast, because Godzilla was back on his feet.

    Godzilla charged Chimerus again, and the lighter chimera jumped midway up one of the buildings that surrounded him. As Godzilla got ready to blast Chimerus, he jumped to a building behind Godzilla, watching Godzilla prepare to blast him there too. He jumped to another building and watched Godzilla vaporised the building, which
    collapsed, like the first one. Once again, Godzilla charged up his breath to blast Chimerus, and Chimerus jumped to another building, then jumped onto Godzilla's side, ripping into it with his claws and teeth. Once more, Godzilla used his Nuclear Pulse. It blasted Chimerus off, and weakened Godzilla a little more as some of his flesh blew out too. Chimerus stood up, exhausted. He had one more trick to try, and then it was over. He knew. Godzilla sent plasma at Chimerus' feet, which made Chimerus jump out of the way, then he jumped at Godzilla, but stopped in front of him, which was not what Godzilla expected him to do. Godzilla had leaned over and spun to try to tail whip Chimerus again. He came back around as Chimerus spun around, swinging his tail with all his might. Because Chimerus didn't have his hands on the ground to give him a better support base, the force with which he swung his tail knocked him over, but it sent his tail spikes into Godzilla's chest, shattering the bones, but not hitting any vital organs.

    Godzilla screamed in pain again, the horrible bell like roar reaching new pitches. His right arm hung useless, and his body was racked in pain. He charged up his breath again and this time, Chimerus was too tired to dodge. It charred his skin and threw him down. Godzilla eyed his foe, and he saw no movement, and he heard no breath. He roared his victory again, and then walked towards the ocean again, using his tail to topple one more building on the fallen Chimerus. It would be no fun destroying a city when he was in as much pain as he was, besides, the city had been evacuated. Nobody was there. He'd come back later.

    The Predator overhead saw it all, but it was the only one.


    ***

    Juan and Park found each other about an hour later. They went looking for Chimerus, but had no luck in finding him.

    "You think Godzilla killed him and dragged him into the ocean?"

    "No, I do not think Godzilla would do that," Park replied. "Besides, we would find evidence of dragging if that was the case."

    They looked around, and finally, they heard a familiar shriek. They followed the noise until they found it's source. Chimerus was breaking out of the rubble that Godzilla had burried him in.

    "Well, Juan, it looks like making him with Godzilla's DNA was a good idea after all."

    "I'd say so."

    Chimerus was not fully healed yet, and his plates were still pale from blood loss, but he was alive, and he was healing visibly. Chimerus the Regisaurus would indeed fight another day.
    Read Stardate 5438 at KaijuGalaxy now!


    Posted Image


    FFKT TOKENS: 15
    Offline Profile Quote Post Goto Top
     
    Zardac the Great
    Member Avatar
    Light Side Sith
    Well, that's the re-write. Your feedback is welcome.

    Next project: Tokyo S.O.S. Remix!
    Read Stardate 5438 at KaijuGalaxy now!


    Posted Image


    FFKT TOKENS: 15
    Offline Profile Quote Post Goto Top
     
    Gigan7
    Member Avatar
    Creator of the Echo series
    I Rather enjoyed this story. You had a few rough spots here and there but overall You kept me very entertained. I liked the Chimarus/human relationship thought it added some nice flavor to the story. I will definitly have to read your third story.
    Check out my new chepo sight for shameless self promotion:
    Echo Universe

    FFKT TOKENS: 14

    Offline Profile Quote Post Goto Top
     
    1 user reading this topic (1 Guest and 0 Anonymous)
    ZetaBoards - Free Forum Hosting
    Free Forums. Reliable service with over 8 years of experience.
    « Previous Topic · Kaiju Fan Fiction, Poetry, and Art · Next Topic »
    Add Reply